14983 results for "cancer studies using rna-seq"

in 14.60 milliseconds.

• Plasma mutation profile of precursor lesions and colorectal cancer using the Oncomine Colon cfDNA Assay

  Colorectal cancer (CRC) is the second leading cause of cancer death worldwide. Early detection of precursor lesions or early-stage cancer could hamper cancer development or improve survival rates. Liquid biopsy, which detects tumor biomarkers, such as mutations, in blood, is a promising avenue for cancer screening. To assess the presence of genetic variants in plasma cell-free tumor DNA from patients with precursor lesions and colorectal cancer using the commercial Oncomine Colon cfDNA Assay. Cell-free DNA (cfDNA) samples from the blood plasma of 52 Brazilian patients were analyzed. Eight patients did not have any significant lesions (five normal colonoscopies and three hyperplastic polyps), 24 exhibited precursor lesions (13 nonadvanced adenomas, ten advanced adenomas, and one sessile serrated lesion), and 20 patients with cancer (CRC). The mutation profile of 14 CRC-associated genes were determined by next-generation sequencing (NGS) using the Oncomine Colon cfDNA Assay in the Ion Torrent PGM/S5 sequencer.

  Dataset EGAD50000000679

• Mutation analysis using AVENIO Expanded in cfDNA

  High resolution mutation analysis using the AVENIO ctDNA Expanded Kit V2, which targets 77 cancer-associated genes, in cfDNA in metastatic breast cancer.

  Dataset EGAD50000001669

• Evaluation of novel therapies using primary cultured gynecological cancer cells and search for predictors of efficacy

  The objective of this study is to establish an optimal method to evaluate the anti-tumor efficacy and biological activity of the novel therapies under investigation in our department using cancer tissues and cells derived from patients with gynecological malignancies in vitro and to evaluate them in practice. This research will contribute to the development of new treatments for gynecological cancer.

  Study JGAS000809

• Single cell RNAseq of PBMC from bladder cancer patients

  This dataset contains single cell RNA sequencing data of PBMC samples from 10 bladder cancer patients. cDNAs and single cell RNA libraries were prepared following manufacturer’s user guide (10x Genomics). Each library was sequenced in HiSeq4000 (Illumina) to achieve ~300 million reads following manufacturer’s sequencing specification.

  Dataset EGAD00001005481

• RNA sequencing of Korean ER positive breast cancer females aged under 35 years old.

  Corresponding data set is composed of RNA sequencing of Korean ER positive breast cancer under 35 years old. This set provides 50 alignment files of 50 tumor samples. This is a part of total project data set.

  Dataset EGAD00001003243

• Dual inhibition of FLT3 and BCL-2 is effective in preclinical models of BCL11B-activated lineage ambiguous leukemia

  Aberrant activation of BCL11B (“BCL11B-a”) defines a subtype of lineage ambiguous leukemias with T-lymphoid and myeloid features, co-occurring activating FLT3 mutations, and a stem/progenitor immunophenotype and gene expression profile. As with other lineage ambiguous leukemias, optimal treatment is unclear and there are limited targeted therapeutic options. Here, we investigated the efficacy of BCL-2 and FLT3 inhibition with venetoclax and gilteritinib, respectively, in preclinical models of BCL11B-a leukemia. Despite variation in response to single agent therapies, the combination of venetoclax plus gilteritinib was highly effective in all models evaluated. BH3 profiling and single cell RNA-seq analysis suggests that resistance to venetoclax and/or gilteritinib monotherapies is due to the tumor-intrinsic activity of BCL-xL and/or MCL-1 prior to drug treatment. These data support clinical evaluation of venetoclax in combination with gilteritinib in BCL11B-a lineage ambiguous leukemias.

  Study EGAS50000000978

• Singel-cell RNA sequencing and CUT&RUN sequencing of human RUNX2-deficient osteoblasts

  Runx2 is a master regulator of bone formation, and its dysfunction causes cleidocranial dysplasia (CCD) in humans. When iPS cells were generated from patients with CCD and Runx2-deficient iPS cells were generated using gene-editing techniques, abnormal laminopathy-like nuclei were observed. Runx2-deficient cells showed reduced Lamin A/C expression, but not protein levels. However, in Runx2-deficient cells, both the gene expression and protein levels of Nesprin-1 were reduced, perinuclear actin fibers were sparser, and nuclear stiffness was reduced. Forced expression of Lamin A/C increased nuclear stiffness but did not improve nuclear morphology. In contrast, the induction of Nesprin-1 expression alone normalized nuclear stiffness and restored nuclear morphology and perinuclear actin distribution. In Runx2-null cells, mechanical stress-induced phosphorylation of emerin was not observed. In contrast, forced expression of nesprin-1 in Runx2-null cells resulted in phosphorylation of emerin, indicating the restoration of intracellular tension. These observations were confirmed by atomic force microscopy. Therefore, the intracellular tension was inferred to pull the nuclear membrane into its normal shape. CUT&RUN assay and single RNA-seq analysis showed that an aberrant nuclear membrane caused loss of nuclear lamina gene regulation machinery, making the progression of normal osteogenic differentiation impossible; however, supplementation with Nesprin-1 restored gene regulation mechanisms and promoted pre-osteoblast formation with normal nuclear morphology. Nesprin-1 expression induced by Runx2 is essential for epigenetic regulation of the nuclear lamina. We propose CCD as a new type of laminopathy involving defective expression of Nesprin-1 regulated by Runx2.

  Study JGAS000663

• S_CORT_Stratification_in_COloRecTal_cancer_

  Colorectal cancer samples will be submitted for Illumina sequencing using a custom capture of 116 genes implicated in colorectal tumourigenesis. Driver mutations will be detected and ultimately correlated with phenotypic data.

  Study EGAS00001001521

• Baylor College of Medicine Advancing Sequencing in Childhood Cancer Care (BASIC3) Clinical Exome Sequencing Study - Clinical Sequencing Exploratory Research Consortium

  The BASIC3 (Baylor College of Medicine Advancing Sequencing in Childhood Cancer Care) study is a National Genome Human Research Institute (NHGRI) and National Cancer Institute-funded Clinical Sequencing Exploratory Research (CSER) consortium project that focuses on prospective implementation of clinical whole exome sequencing in the pediatric oncology clinic. The primary study objective are to integrate information from CLIA-certified germline and tumor exome sequencing into the care of newly diagnosed solid tumor patients at Texas Children's Cancer Center, and to perform parallel evaluation of the impact of tumor and germline exomes on families and physicians. Blood and frozen tumor (if available) samples are collected from children undergoing surgery or biopsy of newly diagnosed solid tumors and subjected to exome sequencing in a CLIA-certified laboratory. Germline and tumor (if applicable) exome sequencing reports are generated and submitted into the electronic health record and returned to each patient/family by their primary oncologist. If specific (optional) consent is obtained, research sequencing studies (including transcriptome sequencing) are performed in addition to the clinical exome sequencing.

  Study phs001026

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• RNA sequencing, ATACseq, and TCR-seq of Tfh cells and CXCR5- CD4+ T cells in HIV infected lymph nodes

  The high dimensional analyses of CD4+ T cells in human lymph nodes are case-based analyses of the TCR repertoire, transcriptome, and epigenetic signatures of various CD4+ T cells in human lymph nodes. The study aims to determine clonal overlap between phenotypically distinct CD4+ T cells and the similarities between these populations on transcriptional and epigenetic levels. This study performs TCR repertoire sequencing using Molecular Identifier Clustering-based Immune Repertoire Sequencing (MIDCIRS). We found clonal overlap between a population of CXCR5- T cells and follicular helper T (Tfh) cells. We also show epigenetic and transcriptional similarities between CXCR5-PD-1+ T cells and Tfh cells. This study shares an overlapping set of donors with phs001548.

  Study phs001849

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• Poikiloderma_syndrome_RNAseq

  We will sequence the RNA of lymphoblast samples, transformed with EBV, which have poikiloderma syndrome with mutations in c16orf57. The aim of the experiment is to characterise RNA structural effects in this disease.

  Study EGAS00001000250

• Genetic Studies in the Hutterites

  We conducted genetic studies of disease-associated quantitative phenotypes, including microbiome and gene expression studies, and common diseases, such as asthma and Alzheimer's disease, by genotyping and/or sequencing in the Hutterites, a founder population of European descent. The Hutterites who have participated in our studies live on communal farms in South Dakota and are related to each other through multiple lines of descent in a 3,657-person, 13-generation pedigree with 64 founders. The small number of founding genomes reduces genetic heterogeneity whereas their communal lifestyle ensures that non-genetic factors are remarkably uniform between individuals. Our sample includes >1,600 subjects who have participated in our studies of fertility (since 1982), asthma, cardiovascular disease and other complex phenotypes (since 1993), microbiome studies (since 2011), and/or immune response (since 2012). The variable 'Total number of consented subjects' reflects the count of subjects with individual level phenotype and genotype data in dbGaP.

  Study phs000185

• Peripheral clonal expansion of T cells (scTCR-seq)

  Single-cell TCR-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005465

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709