11951 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 28.07 milliseconds.

• RNAseq of medulloblastoma data (MB_COMICS cohort)

  Medulloblastoma (MB) is the most common malignant brain tumor in children. It is a neuroectodermal tumor located in the cerebellum. International consensus recognizes four distinct subgroups of MBs including Wingless (WNT), Sonic Hedgehog (SHH), Group 3 (G3), and Group 4 (G4) with distinct molecular characteristics, prognoses, and mortality rates in patients. Here, we have compiled and evaluated a large international MB cohort for which we generated transcriptomic data (RNAseq) for 208 primary MB patient samples.

  Study EGAS50000000410

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Development of blood-based biomarkers for precision medicine in castration-resistant prostate cancer

  Cell-free DNA (cfDNA) testing is emerging as a tool for cancer precision medicine. However, little is known about the clinical significance of low-frequency variants detected in circulating cell-free tumor DNA (ctDNA) from castration-resistant prostate cancer (CRPC) patients. We conducted targeted sequencing of cfDNA and paired leukocyte DNA from CRPC patients using molecular barcodes, and ctDNA variants with a variant allele frequency ??? 0.1% were detected using an in-house pipeline.

  Study JGAS000330

• Deciphering the aggressive nature of morphoeic basal cell carcinoma

  Morphoeic basal cell carcinoma (mBCC) has a high risk of local recurrence compared to the more indolent nodular subtype reflected by a different set of driver mutations including FLNB and HECTD4. Surrounding mBCC stroma is abnormal, containing mutations such as EPHA3. Hedgehog pathway over-expression is seen in both the tumour and stroma of morphoeic tissue with the latter potentially being partly responsible for its aggressive nature and risk of recurrence.

  Study EGAS00001001915

• Sarcopenia related to Head and Neck squamous cell carcinomas: transcriptome modifications of muscle cells induced by distant malignant cells

  The biological mechanisms of sarcopenia are still very poorly understood, particularly in the case of Head and Neck Squamous Cell Carcinomas (HNSCC). However, there is good reason to believe that diffusible factors originating from tumor cells exert a distant deleterious effect on muscle cells. To test this hypothesis we implemented a dual approach based both on experiments carried out in vitro and on the study of muscle fragments from patients.

  Study EGAS50000000669

• High Altitude Pulmonary Hypertension

  The Central Asian Kyrgyz highland population provides a unique opportunity to address genetic diversity and understand the genetic mechanisms underlying hypoxia-induced high altitude pulmonary hypertension (HAPH). While a significant fraction of the population is unaffected, there are susceptible individuals who display HAPH in the absence of any lung, cardiac or hematologic disease. We report herein the analysis of the whole genome sequencing of healthy individuals compared with HAPH patients and other controls.

  Study EGAS00001003171

• IgCaller

  IgCaller is a python program designed to fully characterize the immunoglobulin (IG) gene rearrangements and oncogenic translocations in lymphoid neoplasms from whole-genome sequencing (WGS) data. Using a cohort of 331 patients comprising different subtypes of B-cell neoplasms, we demonstrate that IgCaller identifies both heavy and light chain rearrangements providing additional information on their functionality, somatic mutational status, class switch recombination, and oncogenic IG translocations. We provided here IG reads of the previously unpublished WGS.

  Study EGAS00001004298

• Sequencing of an organoid biobank for childhood soft tissue sarcoma.

  Rhabdomyosarcomas are diverse tumors of mesenchymal origin and the most common childhood soft tissue sarcoma. Patients receive intense treatment with a nevertheless poor prognosis for high-risk patients. New therapy would benefit from additional preclinical models and their rapid establishment. Tumor organoid models (tumoroids) have so far only been established from epithelial cancers. Here, we describe generation and characterization of a collection of pediatric RMS tumoroids comprising all major subtypes.

  Study EGAS00001005912

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Egypt_Genome_Project___low_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate low-coverage sequencing data for 100 Egyptian samples.

  Study EGAS00001000480

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Much ado about nothing? - Off-target amplification can lead to false positive bacterial brain microbiome detection in healthy and Parkinson's disease individuals

  Recent studies suggested the existence of (poly-)microbial infections in human brains. Using 16S rRNA gene amplicon sequencing, we tested the hypothesis that there is a bacterial brain microbiome. We evaluated brain samples from healthy human subjects and individuals suffering from PD (olfactory bulb and pre-frontal cortex). We identified off-target amplification as a major confounding factor in low-bacterial/high-host-DNA scenarios.

  Study EGAS00001004757

• Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma

  Only a few studies have reported the molecular characteristics of adult cerebellar glioblastoma (C-GBM), a subtype comprising 1% of glioblastoma cases located within the infratentorial brain region due to the rarity. By identifying genomic profiles from 19 adult C-GBM samples, we revealed the genetic intertumoral heterogeneity in C-GBM as well as distinct genomic characteristics from those of supratentorial glioblastomas (S-GBMs), emphasizing the need of individualized therapies for C-GBM patients.

  Study EGAS00001002517

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Nasal epithelial cells of PCD and non-PCD patients grown at air-liquid interface for RNAseq analysis

  Raw RNAseq data files of genetically unsolved PCD patients used for transcriptomic analysis aming to uplift the diagnostic rate. The non-PCD patients were used as a clinical comparator to the PCD patients. Majority of the nasal epithelial cells used for RNAseq were cultured at an air-liquid interface for 21 days, unless the data file name indicates a different air-liquid-culture time-point.

  Study EGAS00001006632

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Genetic scoring guide for personalized risk assessment in pediatric B-cell precursor Acute Lymphoblastic Leukemia

  In this study a next-generation sequencing based method was applied to comprehensively screen for recurrent, disease-relevant copy number aberrations in a cohort of Hungarian patients. Diagnostic bone marrow samples from 260 children with B-cell acute lymphoblastic leukemia and were investigated by digital multiplex ligation-dependent probe amplification using the disease-specific D007 probemix. Whole chromosome gains and losses, as well as subchromosomal copy number aberrations were simultaneously profiled.

  Study EGAS00001007239

• Clonal_selection_after_gene_therapy_in_SCD___Duplex_sequencing

  This study includes the targeted duplex sequencing data relating to this study. A custom targeted panel was used including 29 AML-associated genes, and a set of mutations from driver-containing clones that were sequenced during the WGS tree-building phase of the study. Targeted sequencing is performed on each of 6 individuals included at the study at at least 3 time points per individual: one prior to gene therapy, and two post-therapy time points.

  Study EGAS00001007253

• RNA sequencing in primary human macrophages overexpressing ETS2

  We investigated an intergenic haplotype on chr21q22, linked to five different inflammatory diseases, and discovered a mechanism that orchestrates macrophage responses during chronic inflammation. We delineated how the risk haplotype increases expression of the causal gene, ETS2, and demonstrated that ETS2 is necessary for inflammatory macrophage effector functions. To establish whether ETS2 is sufficient to drive inflammatory responses, we overexpressed ETS2 in a dose-dependent manner and performed RNA-sequencing to characterise the transcriptional effects.

  Study EGAS00001007554

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Evaluating gene expression in aggressive B-cell lymphoma using a quantitative nuclease protection assay

  Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), comprising 25-30% of all NHL in developed countries with an annual incidence in the USA of 7 cases/100000 persons/year. Collectively, DLBCL is classified based on a common morphological appearance of diffuse growth of large transformed B-cells, immunophenotype, high proliferation rate and aggressive behaviour. Despite these similarities, DLBCLs are a heterogeneous collection of malignancies with distinct clinical and molecular characteristics that do not always correlate with immunohistological features. This gene expression dataset includes transcriptomes of ABC-DLBCLs and of GCB-DLBCLs where cell of origin is determined by the HTG-EdgeSeq quantitative nuclease protection assay. Also included are clonality results from BCR profiling from high-grade B-cell lymphomas sequenced using a NOVA sequencer

  Dataset EGAD00001011309

• Organ maturation in preparation for birth (Peds RFA) to develop a tissue resource and a single-cell atlas of organ development and maturation for dissemination among the scientific and clinical community: RNA (2025-10-14)

  Knowledge about abnormal organ development is important to understand pathology and to develop novel treatment approaches for individuals with congenital and acquired disease. Most of our current understanding is based on examination of tissues from the embryo and early foetus, collected from women undergoing termination of pregnancy in the first trimester (third) of pregnancy. There is very little known about normal and abnormal organ development from a developmental perspective during the crucial last two-thirds of pregnancy when much remodelling of foetal tissues occurs. This study will generate a single-cell atlas of late-foetal lungs, blood, heart, bone and immune organs. . This dataset contains all the data available for this study on 2025-10-14.

  Dataset EGAD00001015737

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria (2018-03-14)

  Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria. There are more than 100 genes known for congenital disorders of glycosylation and new disorders are discovered each year. WE included patients with a so far unsolved glycosylation disease. The diagnostic group 3-methyglutaconic aciduria is a heterogenous group of disorders mostly caused by abnormal phospholipid synthesis or in association with mitochondrial dysfunction. We included patients with a so far unsolved disease and 3-methylglutaconic aciduria. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2018-03-14.

  Dataset EGAD00001004038

• Acquisition of additional mutations drives accelerated progression of NPM1 positive CMML to AML

  This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .

  Dataset EGAD00001002194

• RNAseq of samples from CLL patients treated with idelalisib in vivo

  The dataset contains RNA sequencing data from 18 paired samples of 9 CLL patients treated with idelalisib in vivo (median time on therapy 4 weeks; range 2-5 weeks).

  Dataset EGAD50000000878

• Whole exome sequencing datasets for Low-grade Serous Ovarian Carcinoma

  This dataset includes whole exome sequencing reads from 10 normal and 14 cell lines based on Agilent SureSelect XT Human All Exon v6. They are all 2*100bp reads sequenced using Illumina HiSeq4000.

  Dataset EGAD00001006440

• An Interim Report on the Investigator-initiated Phase 2 Study of Pembrolizumab Immunological Response Evaluation (INSPIRE)

  Whole exome sequencing BAM files of 50 metastatic solid tumour and matched blood germline DNA prior to pembrolizumab treatment.

  Dataset EGAD00001004873

• RNA-seq

  This dataset contains the raw sequencing data (Runs) for all 10x Genomics single-cell RNA-seq Experiments.

  Dataset EGAD00001009823

• RNA-seq colorectal carcinomas NKI-AvL TGO series Gut2009

  The dataset "RNA-seq colorectal carcinomas NKI-AvL TGO series Gut2009 " includes 2 x 29 fastq files from paired-end mRNA sequencing on Illumina HiSeq2500 for 29 snap-frozen colorectal carcinomas.

  Dataset EGAD00001004059

• RNA-seq colorectal adenomas NKI-AvL TGO series Gut2009

  The dataset "RNA-seq colorectal adenomas NKI-AvL TGO series Gut2009" includes 2 x 32 fastq files from paired-end mRNA sequencing on Illumina HiSeq2500 for 32 snap-frozen colorectal adenomas.

  Dataset EGAD00001004058

• MP-WGS and WES from CCND1-negative MCL

  BAM files from 5 CCND1-negative MCL cases. 4 BAM files corresponded to long insert size Mate Pair-WGS and 3 to WES. In 2 of the cases both technologies were performed.

  Dataset EGAD00001004161

• Whole genome sequencing of an individual's genomic DNA and that of its lymphoblastoid cell line.

  The genetic consequences of cellular transformation by Epstein-Barr-Virus were assessed by comparing whole genome sequences of the original genome (before transformation) and the genome after transformation.

  Dataset EGAD00001000693

• HiChIP bulk

  This dataset gather HiChIP data for H3K27ac mar in MM.1S cell line in control and Dex condition, both in two biological replicates

  Dataset EGAD00001011138

• RNA-seq bulk

  This dataset gather all RNA-sequencing data in MM.1S cell line in control and Dex condition; both in 3 biological replicates

  Dataset EGAD00001011137

• A96225C

  Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A96225C 1034 samples; filetype=bam

  Dataset EGAD00001005355

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428