23155 results for "ega"

in 29.98 milliseconds.

• GoT2D WGS analysis files

  This data set includes the following summary level data files used for the GoT2D WGS analysis: wgs.assoc.samples.list: list of samples to keep for association analysis wgs.assoc.variants.list: list of variants to keep for association analysis wgs.sv.assoc.txt: single variant association results

  Dataset EGAD00010001185

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• arcOGEN_HumanCoreExome-24v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-24v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000927

• arcOGEN_HumanCoreExome-12v1-1_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-1 with consent for osteoarthritis studies only.

  Dataset EGAD00010000924

• arcOGEN_HumanCoreExome-12v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000923

• usgwas-QC_update

  Understanding Society GWAS, samples that passed quality control

  Dataset EGAD00010000891

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Array data for oesophageal and related samples – sj_paper_methyl_normal_release

  Array data for oesophageal and related samples – sj_paper_methyl_normal_release

  Dataset EGAD00010001834

• Colorectal-Cancer-Tumor-Spheres-H012-Microarray_Expression

  Gene expression of 12 colon cancer TSCs (sensitive or resistant) after 12h treatment with 3µM NCT02 or DMSO (control) was analyzed using Illumina microarrays (HumanHT-12 v4 BeadChip).

  Dataset EGAD00010001936

• Ni_Vanuatu_Omni2.5

  Blood DNA samples from 1,433 contemporary ni-Vanuatu were genotyped on the Illumina Infinium Omni 2.5-8 array. Genotype calling was performed using the Illumina GenomeStudio software.

  Dataset EGAD00010002344

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• Average_hypermethylation_TF_sites

  Average hypermethylation on transcription factor binding sites based on nanopolish calls; only positions showing higher methylation than sample’s average methylation at enhancers were included when defining the average methylation level. Data from 6 individuals at different time points.

  Dataset EGAD00010002411

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Genotype data for African Esophageal squamous cell cancer cases and controls from South Africa

  This dataset contains the cleaned genotype data from 2173 African eosphageal squamous cell cancer cases and population controls. The genotype data was generated using the H3Africa Illumina Custom microarray.

  Dataset EGAD00010002575

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• mCEL-Seq2 analysis of human brain tissues and border regions

  mCEL-Seq2 analysis with reference mapping of human brain tissues and border regions

  Dataset EGAD50000000046

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Mutation detection of T follicular helper cell lymphomas

  Whole-exome sequencing data for study of tumor heterogeneity and immune-evasive microenvironment in T follicular helper cell lymphomas

  Study EGAS50000000276

• Sanger sequencing of MV4-11 cell lines targeting the TP53 R284 locus

  Sanger sequencing data of cell lines derived from bulk MV4-11 cells, targeting the R248 locus of TP53, consisting of either wildtype or homozygous mutant lines.

  Dataset EGAD50000000447

• Perturb-seq on CRC

  Systematic, genome-wide Investigation of enhancer regions in colorectal cancer. We used scRNA-seq with CRISPRi/dCas9 inhibition of 12,117 regions.

  Study EGAS50000000256

• CRC cell line RNA-seq

  RNA-Seq data for C32, CACO2, CL11, HT29, SW403, SW948 MSS CRC cell lines and HCEC-1CT normal colon cell line

  Dataset EGAD50000000297

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• 16SV4 ribosomal RNA gene sequencing data

  16SV4 ribosomal RNA gene sequencing data of GI samples and associated mixed community cultures collected from pediatric patients at risk for IBD.

  Dataset EGAD50000000485

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• scATAC-seq of sorted CD45+ cells from blood and tissues

  scATAC-seq by 10xGenomics Droplet Sequencing from two human donors. scATAC sequences are available for FACS-sorted CD45+ cells from blodd, skin and vat (visceral adipose tissue)

  Dataset EGAD50000000510

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• Center for Technology Licensing at Cornell University for data associated with Nature Medicine 2024 paper

  For data access to plasma/tumor/normal samples from the manuscript "Ultrasensitive plasma-based monitoring of tumor burden using machine learning-guided signal enrichment" from Widman et al. Nature Medicine 2024

  Dac EGAC50000000207

• Human dorsal root ganglia after plexus injury - RNA-fragment sequencing from histological slices dataset

  Transcriptome profiling of Human dorsal root ganglia after plexus injury based on low Input Total RNA-seq from FFPE material

  Dataset EGAD50000000959

• RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives to investigate alterations in gene expression associated with MLH1 epimutation

  Dataset EGAD50000000712

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• CIRCLE-seq of PDO

  CIRCLE-seq data of PDAC 1 patient-derived organoid (PDO) - Unmapped reads, libraries were sequenced using the Illumina NextSeq500 with the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles), generating around 10M paired end 150bp reads per sample

  Dataset EGAD50000000281

• WGS of PDO in depleted media

  Whole genome sequencing profiling of 7 PDAC patient-derived organoids (PDO) grown in a culture medium lacking both WNT3A and RSPO1- WGS unmapped reads, sequenced using NovaSeq 6000, 15x coverage 160 million reads per sample.

  Dataset EGAD50000000282

• H3Africa ACEGID Omni Array Phenotype

  Phenotype data for Lassa Fever cases and population controls from Nigeria and Sierra Leone associated with genotype data generated using Illumina Omni 2.5M and 5M.

  Dataset EGAD00001010922

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495