22958 results for "ega"

in 25.63 milliseconds.

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Analysis of cell type contributions to cell free DNA in health and disease.

  This study looks at cell type contributions to cell free DNA in health and disease.

  Study EGAS50000000178

• Studying the cellular diversity of the human hypothalamus

  We use single-cell and spatial transcriptomics to catalogue cellular populations and their locations in the human hypothalamus

  Study EGAS50000000716

• H3K27Ac ChIP-seq of 9 cHL cell lines

  The dataset contains 36 ChIP-seq data for H3K27Ac and their corresponging inputs for 9 cHL cell lines. Data are raw paired-end fasq files for each histone and input, and for each cell line.

  Dataset EGAD50000001272

• South African breast cancer GWAS genotype data in VCF format

  South African breast cancer GWAS genotype data for 2823 female African breast cancer cases. The data was generated using the H3Africa Custom microarray and genotyped on the Illumina HiScan instrument. The dataset is in VCF format.

  Dataset EGAD00010002732

• Clinical and ctDNA data for IMpassion031

  Clinical and ctDNA data for IMpassion031, including survival, response, and ctDNA data from baseline through post-surgery time points. 222 samples run on Signatera assay. File type is csv.

  Dataset EGAD50000001420

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• WGS data of isogenic wild-type RPE1

  Deposited here are WGS data generated from isogenic wild-type (WT) RPE1 untreated and treated with brequinar for 42 days (and other dNTP-pool disruptor compounds)

  Dataset EGAD50000001602

• WGS dataset for two NUP98-Rearranged Acute Myeloid Leukemia PDX samples

  This dataset includes whole genome sequencing of two patient-derived xenograft (PDX) samples with NUP98-Rearranged Acute Myeloid Leukemia. Bam files are provided for each sample.

  Dataset EGAD50000001563

• Meniere Disease Genomic Data Access Committee

  This Data Access Committee is responsible for reviewing and managing data access requests related to genomic variant files from whole exome sequencing of patients diagnosed with Meniere disease. This includes data from both familial and sporadic forms of the disease.

  Dac EGAC50000000708

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• pediatric AML genomic sequences

  This dataset contains whole sequencing data from 30 patients with pediatric AML. For each patient, there is one dataset derived from tumor cells and one dataset derived from a matched non-malignant control.

  Dataset EGAD50000001572

• WGS FASTQ files studied in Allogeneic induced pluripotent stem (iPS) cell-derived cartilage transplantation for articular cartilage damage in knee joints: a phase I, first-in-human study

  This data set contains 5 paired fastq files (WGS).

  Dataset EGAD50000001666

• Chromatin accessibility profiling of primary human hepatocytes

  The chromatin accessibility profiling of primary human hepatocytes using Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq).

  Study EGAS50000001230

• Spatial transcriptomics analysis of triple negative breast cancers

  Spatial transcriptomics analysis of triple negative breast cancers Both bulk sequencing and ST were performed Counts, images etc are available at https://zenodo.org/doi/10.5281/zenodo.8135721

  Dataset EGAD50000000686

• WGS data from COMPASS Trial

  WGS data for pancreatic cancer samples (COMPASS Trial; Knox et al., Journal of Clinical Oncology, 2025). The dataset includes tumour and normal BAM files sequenced on Illumina HiSeq/NovaSeq and aligned against GRCh38 (n=263 tumour/normal pairs).

  Dataset EGAD50000001832

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Micro-C sequencing of pediatric BCP ALL

  Micro-C sequencing data of 35 B-cell precursor (BCP) acute lymphoblastic leukemia (ALL) cases were constructed on an Illumina NovaSeq 6000 Sequencing System.

  Dataset EGAD50000001124

• RNA sequencing of pediatric BCP ALL

  RNA sequencing data of 33 B-cell precursor (BCP) acute lymphoblastic leukemia (ALL) cases were constructed on an Illumina nextseq 2000 Sequencing System.

  Dataset EGAD50000001125

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• RNA-seq of chordoma samples

  This dataset contains paired-end bulk RNA-seq data of advanced chordoma samples from 7 patients. Sequencing was performed on Illumina HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001019

• Clinical Utility of BRCA Research by Inocras, CMC and SMC (CUBRICS)

  This dataset consists of transcriptome data available for most cases of the whole-genome sequences from 1,364 Korean breast cancers

  Dataset EGAD50000001993

• Visium CytAssist Spatial Gene Expression analysis for FFPE glioblastoma samples

  This study used spatial transcriptomics to investigate gene expression patterns in FFPE glioblastoma tumor samples from four patients.

  Study EGAS50000001242

• Multi-omics characterisation of immune cells in Long Covid

  We generated 10X Multiomics (paired RNA+ATAC) for Long Covid patients with up to 14 months follow-up.

  Study EGAS50000000142

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300