21177 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 37.12 milliseconds.

• Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Study EGAS00001003876

• raw RNA-seq data from patients infected with COVID-19 or influenza

  Dataset consists of fastq files from bulk RNA-seq done on peripheral blood acquired from two well characterised hospitalised cohorts, a cohort of patients infected with influenza and a cohort of patients infected with SARS-CoV-2 during the first wave of the pandemic and prior to availability of COVID-19 treatments and vaccines.

  Dataset EGAD00001008505

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - DNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009812

• Patient-Parent trio sequencing for 100 sporadic ID patients

  Single end short-read (50 bp) SOLiD 4 sequencing data for 300 individuals, constituting 100 patient-parent trios. For more details please read; http://www.nejm.org/doi/full/10.1056/NEJMoa1206524

  Dataset EGAD00001000680

• DAC for Melanoma Exome Dataset for Identification of Mutated Epitopes

  Dac EGAC00001000546

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002208

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303

• DAC for Sarcopenia HNSCC

  Data access committee for Sarcopenia HNSCC study

  Dac EGAC50000000420

• ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  Dataset EGAD00001002238

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• DAC for study Screening for abnormal CGI methylation in primary colorectal tumours

  Dac EGAC00001000069

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• Sequencing data for oesophageal and related samples - OACs release 4 (RNA)

  Dataset EGAD00001004021

• Leukemia WGS data

  Whole-genome sequencing data from 38 leukemia patients and 12 leukemia cell lines; Containing 100 fastq files; Two files for each sample.

  Dataset EGAD00001008659

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949

• monozygotic twin discordant for schizophrenia

  monozygotic twin discordant for schizophrenia

  Dataset EGAD00001000048

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors

  Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors, 25 samples with paired fastq files, sequenced on Illumina-HiSeq_X_Ten and using the Illumina_TruSeq_Nano_DNA kit.

  Dataset EGAD00001009094

• whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors

  Paired whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors, sequenced on Illumina HiSeq 4000 and using the Agilent SureSelect V5+UTRs Kit.

  Dataset EGAD00001009095

• Single cell RNA-sequencing (scRNA-seq) of the human hematopoietic stem cell compartment (CD34+CD38-CD45RA-)

  To identify a trajectory of human hematopoietic stem cell (HSC) activation single cell gene expression profiling of RNA from human HSC was performed by flow cytometry-based single cell deposition of CD34+CD38—CD45RA—cells from G-CSF-mobilized peripheral blood from 3 individual donors and 1 bone marrow donor in concert with single cell index-sorting (signals indexed: CD34, CD38, CD45RA, CD90, CD49f) and followed by SMARTseq2 based protocol. We show that INKA1 and CDK6/PAK4 expressing single cells segregate across alternative states of quiescence.

  Study EGAS00001004769

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• Data access committee for RNA-seq as a tool for evaluating human embryo competence

  Dac EGAC00001001215

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003606

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003612

• Genome and transcriptome sequence data from an adenocarcimona of the lung patient

  Genome and transcriptome sequence data from an adenocarcimona of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003616

• Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient

  Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004598

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004627

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004619

• Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient

  Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004618

• Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient

  Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004615