16787 results for "sec+and+unspecified+malignant+neoplasm"

in 23.65 milliseconds.

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Reactivation of telomerase reverse transcriptase (TERT) expression enables cells to overcome replicative senescence and escape apoptosis, fundamental steps in the initiation of human cancer. Multiple cancer types, including up to 83% of glioblastomas (GBM), harbor highly recurrent TERT promoter mutations of unknown function but specific to two nucleotide positions. We identify the functional consequence of these mutations in GBM to be recruitment of the multimeric GABP transcription factor specifically to the mutant promoter. Allelic recruitment of GABP is consistently observed across four cancer types, highlighting a shared mechanism underlying TERT reactivation. Tandem flanking native ETS motifs critically cooperate with these mutations to activate TERT, likely by facilitating GABP heterotetramer binding. GABP thus directly links TERT promoter mutations to aberrant expression in multiple cancers.

  Study EGAS00001001242

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• Genetic Epidemiology of Ovarian Cancer Histotypes

  Epithelial ovarian cancer is a highly fatal malignancy with known genetic etiology; however, it is estimated that a substantial portion of narrow sense heritability remains to be discovered. The goal of this research was to use genetic information from distantly related ovarian cancer cases to identify regions of the genome that may harbor rare risk variants for epithelial ovarian cancer. The study was conducted in the setting of the Utah Population Database, a statewide data resource in which extensive ancestry data are linked to Utah Cancer Registry records. Focusing on families with a statistically significant excess risk of epithelial ovarian cancer, we used the Infinium Global Screening Array v.3.0 to generate germline genotyping data for distantly related cases. We then applied Shared Genomic Segment Analysis to each set of related cases to identify genomic regions that may harbor ovarian cancer risk variants. Eleven regions were identified. Genotype data are available through dbGaP for one case from each pedigree. Genotype data from other ovarian cancer cases within the high-risk pedigrees as well as the pedigrees' corresponding structures can be requested and made available with approval from the Utah Resource for Genetic and Epidemiologic Research (RGE).

  Study phs003140

• Residual ANTXR1+ myofibroblasts after chemotherapy inhibit anti-tumor immunity via YAP1 signaling pathway

  Although cancer-associated fibroblast (CAF) heterogeneity is well-established, the impact of chemotherapy on CAF populations remains poorly understood. We address this question in high-grade serous ovarian cancer (HGSOC), in which we previously identified 4 CAF populations. While the global content in stroma increases in HGSOC after chemotherapy, the proportion of FAP+ CAF (also called CAF-S1) decreases. Still, maintenance of high residual CAF-S1 content after chemotherapy is associated with reduced CD8+ T lymphocyte density and poor patient prognosis, emphasizing the importance of CAF-S1 reduction upon treatment. Single cell analysis, spatial transcriptomics and immunohistochemistry reveal that the content in the ECM-producing ANTXR1+ CAF-S1 cluster (ECM-myCAF) is the most affected by chemotherapy. Moreover, functional assays demonstrate that ECM-myCAF isolated from HGSOC reduce CD8+ T-cell cytotoxicity through a Yes Associated Protein 1 (YAP1)-dependent mechanism. Thus, efficient inhibition after treatment of YAP1-signaling pathway in the ECM-myCAF cluster is required to enhance CD8+ T-cell cytotoxicity. Altogether, these data pave the way for novel therapy targeting YAP1 in ECM-myCAF in HGSOC.

  Study EGAS50000000136

• Kidney_transplant_nephrectomy_scRNAseq

  Single cell transcriptomics study of tissue from human kidney transplant nephrectomies Tissue is acquired from kidney transplant nephrectomies, homogenised and disaggregated to a single cell suspension prior to droplet encapsulation single cell RNAseq (10X protocol) or plate based single cell RNAseq (SS2 protocol). Human tissues, including the kidney are seeded with a tissue resident immune cell network throughout life. These cells may self renew in situ or be replaced by circulating precursors which enter the tissue in response to tissue specific niche and inflammatory signals. We are using single cell RNA sequencing of kidney transplant nephrectomy tissue to 1) understand the immune cell populations which are resident within the human kidney 2) identify which of these populations is donor or recipient derived. 3) Uncover the temporal dynamics of donor/recipient chimerism in the the human kidney following transplantation. 4) Understand transcriptional differences between organs removed for a variety of reasons (infection, chronic rejection, vascular emergencies) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003935

• De novo assembly of 150 Danish genomes reveals rich structural complexity

  Most known genetic variation in human genomes has been called from comparison of short reads to the reference genome, an approach biased against finding complex variation. We sequenced 150 individuals from 50 parent-offspring trios with multiple insert-size libraries to very high coverage. We show that each genome could be independently de novo assembled into a small number of high-quality scaffolds (median N50 > 21 Mb), each of quality comparable to long read assemblies while being very cost-effective. We show that our variant call set from comparing de novo assemblies is far more complete in terms of complex variation than previous studies. Importantly, even the complex 4-5 Mb extended MHC region was assembled and resolved into haplotypes, revealing >700kb novel sequence in this important region of the genome, and major parts of the Y chromosome including some palindromes were assembled with high accuracy. Finally, we show that our variant call-set allows for the genotyping of many more complex variants when used as a reference-panel for imputation into SNP-chip data or into previously resequenced genomes.

  Study EGAS00001002108

• Target gene sequencing for human normal endometrial glands

  To elucidate the timing and mechanism of the clonal expansion of somatic mutations in cancer-associated genes in the normal endometrium, we conducted target sequencing of 112 genes for 1,298 endometrial glands and matched blood samples from 36 women. By collecting endometrial glands from different parts of the endometrium, we showed that multiple glands with the same somatic mutations occupied substantial areas of the endometrium. The 112 genes are as follows: ABCC1, ACRC, ANK3, ARHGAP35, ARID1A, ARID5B, ATCAY, ATM, ATR, BARD1, BCOR, BRCA1, BRCA2, BRD4, BRIP1, CAMTA1, CDC23, CDYL, CFAP54, CHD4, CHEK1, CHEK2, CTCF, CTNNB1, CUX1, DGKA, DISP2, DYNC2H1, EMSY, FAAP24, FAM135B, FAM175A, FAM65C, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCL, FANCM, FAT1, FAT3, FBN2, FBXW7, FGFR2, FRG1, GPR50, HEATR1, HIST1H4B, HNRNPCL1, HOOK3, KIAA1109, KIF26A, KMT2B, KMT2C, KRAS, LAMA2, LRP1B, MLH1, MON2, MRE11A, MSH2, MSH6, MTOR, NBN, PALB2, PHEX, PIK3CA, PIK3R1, PLXNB2, PLXND1, PMS2, POLE, POLR3B, PPP2R1A, PTEN, PTPN13, RAD50, RAD51, RAD51B, RAD51C, RAD51D, RAD52, RAD54B, RAD54L, RICTOR, SACS, SIGLEC9, SLC19A1, SLX4, SPEG, STT3A, TAF1, TAF2, TAS2R31, TFAP2C, TNC, TONSL, TP53, TTC6, UBA7, VNN1, WT1, XIRP2, ZBED6, ZC3H13, ZFHX3, ZFHX4, ZMYM4.

  Study EGAS00001005914

• Targeted and Whole Exome Sequencing for Validation of PGDx elio tissue complete

  This dataset consists of 116 tumor and normal samples analyzed with whole exome sequencing on the HiSeq2500 instruments with 100bp paired-end reads as well as 760 tumor and normal samples analyzed with the PGDx elio tissue complete assay. The PGDx elio tissue complete assay is a hybrid capture approach targeting 500+ genes with sequencing on the NextSeq instruments with 150bp paired-end reads. The bam files provided have been adapter masked and contain duplicate reads.

  Dataset EGAD00001008099

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Spatial transcriptomics analysis of triple negative breast cancers

  Spatial transcriptomics analysis of triple negative breast cancers Both bulk sequencing and ST were performed Counts, images etc are available at https://zenodo.org/doi/10.5281/zenodo.8135721

  Dataset EGAD50000000686

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236