12443 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 15.57 milliseconds.

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• Long-read whole genome sequencing as a tool for variant detection in inherited retinal dystrophies

  WGS sequencing using nanopore long reads sequencing. These data is used for the diagnosis of patients with inherited retinal dystrophies.

  Study EGAS50000000846

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• cfDNA sWGS BAM — Metastatic colorectal cancer

  Plasma cirDNA sWGS for metastatic colorectal adenocarcinoma at diagnosis prior to systemic therapy. Libraries DSP/SSP (per sample). Sequencing by IntegraGen (2022–2024). Alignment: GRCh38 with BWA-MEM; BAMs sorted/indexed; delivered as primary mapped reads only (filters/MAPQ in analysis metadata). Controlled access

  Dataset EGAD50000001879

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Ultra-long whole-genome and Cas9-targeted nanopore sequencing of fibroblasts: FSHD, BAMS, healthy controls

  Data from the D4Z4End2End study (Xiao et al. 2025), for genetic and epigenetic analysis of the D4Z4 macrosatellite in health and disease.

  Dataset EGAD50000001551

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295