7189 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 47.81 milliseconds.

• RNA-seq analysis of TGF-β-induced transcriptional changes in 19TT cancer-associated fibroblasts

  The dataset contains 6 samples, three biological replicates for vehicle-treated 19TT cells, and three biological replicates for TGF-β-treated 19TT cells. The dataset was generated by the next generation high throughput sequencing. Strand specific transcriptome library construction is completed by enriching mRNA from total RNA, sequenced by DNBSEQ high throughput platform.

  Dataset EGAD50000001350

• ImmuNEO CD8 cell lines

  Paired RNA-Seq data from 16 samples of different tumors CD8+ T cells added to the study "Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)". Sequencing was performed on Illumina NextSeq 500. The sequencing was always paired

  Dataset EGAD50000000193

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Dataset for RNA and Exome sequencing of Glioblastoma samples

  This dataset contains RNA Seq, 10x scRNA Seq and Exome sequencing of glioblastoma samples. Sequencing was performed on a Illumina NovaSeq 6000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001012235

• An Integrated Approach to Patient Stratification and Therapy Selection in Acute Myeloid Leukemia

  As more clinically-relevant genomic features of myeloid malignancies are revealed, it has become clear that targeted clinical genetic testing is inadequate for risk stratification. Here, we developed and validated a clinical transcriptome-based assay for stratification of acute myeloid leukemia (AML). Comparison of RNA-Seq to whole genome and exome sequencing revealed that as a standalone assay, RNA-Seq offered the greatest diagnostic return, enabling identification of expressed gene fusions, single nucleotide and short insertion/deletion variants, and whole-transcriptome expression information. Expression data were used to develop a novel risk score which, when combined with molecular risk guidelines, allowed for the re-stratification of 22.1 to 25.3% of AML patients from three independent cohorts into correct risk groups. Within the adverse-risk subgroup, we identified a subset of patients characterized by dysregulated integrin signaling and RUNX1 or TP53 mutation. We show that these patients may benefit from therapy with inhibitors of focal adhesion kinase (PTK2), demonstrating additional utility of transcriptome-based testing for therapy selection in myeloid malignancy.

  Dataset EGAD00001006701

• Evolutionary Analysis of Chronic Lymphocytic Leukemia Cells During Relapse After Allogeneic Hematopoietic Stem Cell Transplant

  We investigated the molecular dynamics driving relapse of chronic lymphocytic leukemia (CLL) following allogeneic hematopoietic stem cell transplant (allo-HSCT) through an integrated analysis of whole exome, bulk transcriptome, bulk methylome and single cell transcriptional data from paired leukemic samples representing 19 patients. We found that their clinical kinetics corresponded to distinct genetic and epigenetic evolutionary trajectories and suggest that the selection pressures of the post-transplant, immunologic bottleneck are distinct from those imposed by chemotherapy.In order to discover cancer antigens derived from annotated and unannotated protein-coding regions of the genome, we carried out ribosome profiling (Ribo-seq) and RNA-sequencing on CLL samples and isolated primary B cells from healthy donors. We discovered novel or unannotated open reading frames (nuORFs), their expression levels, as well as somatic mutations within them to predict potential neoantigens.

  Study phs001998

• Identification and characterization of tertiary lymphoid structures in brain metastases

  Brain metastases (BrM) are the most common cancers in the brain. We performed transcriptome-wide gene expression profiling combined with spatial immune cell profiling to characterize the tumor immune microenvironment in BrM from different primary tumors. We found that BrM from lung carcinoma and malignant melanoma showed overall higher immune cell infiltration as compared to BrM from breast carcinoma. RNA sequencing-based immune cell deconvolution revealed gene expression signatures indicative of tertiary lymphoid structures (TLS) in subsets of BrM from lung cancer and melanoma. This finding was corroborated by multiplex immunofluorescence staining of immune cells in BrM tissue sections. Detection of TLS signatures was associated with prolonged survival after BrM diagnosis in lung cancer patients. Our findings highlight the cellular diversity of the tumor immune microenvironment in BrM of different cancer types and suggest a role of TLS formation for BrM patient outcome.

  Study EGAS50000000563

• Single-cell omics data for COVID-19 patients

  Single-cell RNA-seq, single-cell ATAC-seq, and genotypes used in the analysis for the study "Altered and allele-specific open chromatin landscape reveal epigenetic and genetic regulators of innate immunity in COVID-19". The RNA-seq and ATAC-seq are raw data in FASTQ format while the genotypes are in the VCF format which was filtered and imputed (more details are available in the main text of the study).

  Dataset EGAD00001009331

• Paired RNA-Seq data of Primary lymphomas of the central nervous system (PCNSL)

  Primary lymphomas of the central nervous system (PCNSL) are diffuse large B-cell lymphomas (DLBCLs) which are confined to the central nervous system (CNS). Paired RNA-Seq sequencing was done on Illumina HiSeq2000 machines using Illumina TruSeq RNA library preparation kit. About 36 tumor samples were sequenced.

  Dataset EGAD00001007811

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• A Pilot Study of Rapid Autopsy and Procurement of Tissue in Thoracic Malignancy Cancer Patients to Investigate Tumor Heterogeneity

  Integrated proteo-genomics studies to characterize tumor heterogeneity of metastatic lung adenocarcinoma and thymic carcinoma are lacking. We carried out whole exome sequencing, RNA sequencing, copy number estimation and mass spectrometry-based proteomics of 40 tumors from five rapid/warm autopsy patients. We found highly variable mutational heterogeneity that was largely driven by APOBEC-mutagenesis with the expression of APOBEC3B (Gene ID: 9582) and APOBEC3A_B (Gene ID: 100913187) due to underlying APOBEC3 region germline variants as the likely mediating mechanism. APOBEC3A_B expression was associated with increased immune tumor microenvironment and CD274 (Gene ID: 29126) expression while smoking was associated with increased APOBEC-mutagenesis in TP53 (Gene ID: 7157) mutant tumors with high APOBEC3B expression. Heterogeneity at the level of the transcriptome and proteome occurred in association with copy number heterogeneity, not APOBEC-induced mutational heterogeneity. Arm and focal copy number alterations (CNAs) occurred as an evolutionarily late event in a subset of patients, with corresponding changes in the transcriptome and proteome, implicating CNAs as a driving force of heterogeneity in the evolution of metastatic disease.

  Study phs001432

• Reproducibility of 10x Genomics single cell RNA sequencing method in the immune cell environment

  Study EGAS00001005905

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• BRCA Mutation Status Shapes the Microenvironment of Pancreatic Adenocarcinoma

  This study was established in order to address how the stromal landscape is influenced by BRCA-mutated and BRCA Wild-type (WT) pancreatic ductal adenocarcinoma (PDAC). A primary cohort of 12 PDAC patients (7 BRCA-WT and 5 germline BRCA-mut) was analyzed by laser-capture microdissection, RNA-sequencing and multiplexed immunofluorescence.

  Study phs002994

• Identification of the cause of juvenile parkinsonism in a case_SYNJ1

  This study aimed to elucidate the genetic causes underlying the Juvenile Parkinsonism diagnosed in a girl using whole-exome sequencing, analysis of CAG repeats, RNA sequencing analysis on fibroblasts, and metabolite identification. As a result, a homozygous missense mutation SNP T/C (rs2254562) in SYNJ1 and alteration in metabolism were identified.

  Study EGAS00001007686

• Ex vivo modeling of precision immuno-oncology responses in lung cancer

  Single-cell RNA-sequencing (scRNA-seq) data from paired lung cancer organoids and immune cells. The experiment was performed using the Single Cell 5' solution of 10X Genomics. The dataset includes 15 samples from 4 multiplexed experiments. The multiplexing was performed using the Feature Barcoding technology of 10X Genomics.

  Study EGAS50000000593

• Elucidation of the association of the HPV integration and oropharyngeal cancer

  Whole-genome sequencing was performed using tumor and blood samples from 14 patients with HPV-associated oropharyngeal cancer. Bulk RNA sequencing was performed using tumor samples from 19 patients with HPV-associated oropharyngeal cancer and 17 patients with non-HPV-associated oropharyngeal cancer and normal tonsil samples from 2 healthy controls.

  Study JGAS000751

• RNA-sequence analysis in patients with inclusion body myositis

  This study aimed to elucidate the molecular features of inclusion body myositis (IBM). We performed RNA sequencing analysis of muscle biopsy samples from myositis patients with the pathological finding of CD8-positive T cells invading non-necrotic muscle fibers expressing major histocompatibility complex class I (IBM, polymyositis, and unclassifiable myositis), and controls.

  Study JGAS000068

• Oncogenic gene fusions in primary colon cancers

  This study represents RNA-sequencing data from 278 primary colon cancers obtained from fresh-frozen tumor sections. The project goal was to identify novel oncogenic gene fusions in these data. In addition, we studied the detected gene fusions at the molecular level and defined their effects on downstream pathways.

  Study EGAS00001002197

• The genomic landscape of primary cutaneous anaplastic large cell lymphoma (pcALCL)

  Primary cutaneous anaplastic large cell lymphoma (pcALCL) is the second most common variant of cutaneous T-cell lymphoma. We subjected tumor biopsies from patients with pcALCL to whole-genome sequencing, whole-exome sequencing and RNA-sequencing to investigate genomic alterations and deregulated gene expression in the disease.

  Study EGAS00001004429

• Comparison of fresh and slow-frozen cancer samples for different applications

  Surplus tissues from multiple solid human cancers directly slow-frozen after resection can subsequently be used for different types of methods including the establishment of 2D, 3D, and ex vivo cultures as well as single cell RNA sequencing (scRNAseq) with similar results when compared to freshly analyzed material.

  Study EGAS00001005891

• Natural Killer Cell Plasticity During IL-15-driven Homeostatic Proliferation

  Here we performed single-cell RNA sequencing to address repertoire stability and subset plasticity during IL-15 driven homeostatic proliferation. Sorted NK cell subsets representing discrete stages of NK cell differentiation are compared with the corresponding subsets after proliferation and further sorted into two subsets depending on the rate of proliferation.

  Study EGAS00001003946

• Transcriptomic signatures of CD4+ T cells from visceral leishmaniasis (VL) patients

  Bulk RNA-sequencing was performed on CD4+ T cells isolated from the blood of visceral leishmaniasis patients (n = 12) and endemic controls (EC; n = 12). CD4+ T cells were obtained by magnetic-activated cell sorting (MACS). Alterations in the transcripts of T helper (Th) cells during infection were identified.

  Study EGAS00001004152

• Personalised Mapping of Tumour Development in Synchronous Colorectal Cancer Patients

  We performed an in-depth characterisation of 12 tumours from 3 syCRC patients by analysing histopathological, whole genome sequencing and RNA-sequencing data. We assessed the extent of genetic overlap between synchronous tumours and examined associations between clinicopathological information and the molecular, microbial and immune features of each tumour genome.

  Study EGAS00001004413

• Smart-seq3 scRNA-seq of cells from primary (OV2295) and metastatic (OV2295R2) high-grade serous ovarian cancer cell-line

  In this project, single cells extracted from two high-grade serous ovarian cancer cell-lines, one primary (OV2295) and one metastatic (OV2295R2), where split into two 384 well plates and libraries were prepared using Smart-seq3 single cell RNA sequencing (Hagemann-Jensen et al, 2020).

  Study EGAS00001006868

• 3D-GSC_expression_profiles

  In this study, we used RNA-sequencing gene expression profiling in order to characterize specific phenotypic traits in DIPG-derived glioma stem cell (GSC) models. Twenty-two primary GSC models derived from biopsies collected at diagnosis were cultured in an ECM-mimicking compound before for RNA extraction and subsequent rRNA-depletion and sequencing .

  Study EGAS00001007182

• RNA sequencing from patient-derived intestinal organoids

  RNA from the duodenal organoids was isolated using an RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA purity and concentration were measured using a NanoDrop One spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Preparation of the RNA library and transcriptome sequencing was conducted by Novogene Co., LTD (Cambridge, UK). Messenger RNA was purified from total RNA using polyA selection and subjected to library construction. Sequencing was performed on an Illumina platform, and 150 bp paired-end reads were generated.

  Study EGAS50000000338

• Single-Cell and Spatial Multi-Omics Highlight Effects of Anti-Integrin Therapy Across Cellular Compartments in Ulcerative Colitis

  This is a focused, nested case-control study within our larger cohort "Immunoprofiling of the Blood and Intestine and Creation of a Gut Cell Atlas". This sub-study is titled as "Single-cell and spatial multi-omics highlight effects of anti-integrin therapy across cellular compartments in ulcerative colitis”. We examined the impact of Vedolizumab (VDZ), an anti-integrin antibody therapy, on the cellular landscape of ulcerative colitis (UC). While VDZ is primarily recognized for its role in preventing lymphocyte migration to the gut, the extent of its influence on other cellular populations has not been fully characterized. We used single-cell RNA sequencing (scRNA-seq) and cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) to profile cells from both the blood and colon tissue samples. We pooled single-cell suspensions together before running scRNA-seq and CITE-seq, and subsequently deconvoluted the samples using the freemuxlet and demuxlet algorithms and variant call files (vcf) from bulk RNA-seq. This allowed us to assign cells to individual study subjects. We compared the cellular compositions of healthy individuals to those of UC patients undergoing treatment with VDZ or mesalamine (5-aminosalicylic acid/5-ASA). Our results revealed that VDZ induces significant changes in the variety and dynamics of mononuclear phagocytes within both the bloodstream and intestinal tissue, accompanied by subtle variations in lymphocyte populations. The dbGaP submission will provide raw sequencing data and participant phenotype data regarding disease and treatment status.

  Study phs003502

• Adrenal scRNA sequencing data access

  Raw sequencing datasets for manuscript "Hybrid untargeted and targeted RNA sequencing facilitates genotype-phenotype associations at single-cell resolution".

  Dac EGAC50000000869

• Pseudogene RNAseq

  RNA sequencing to validate findings of somatic pseudogenes acquired during cancer development

  Dataset EGAD00001000732

• Deciphering molecular mechanisms underlying hematological malignancies and development of novel therapeutic approaches

  We aim to identify epigenomic features dysregulated in hematological malignancies through epigenetic analyses of hematological malignant cells. We also perform RNA sequencing to profile tumor cell-specific transcriptomes and target gene sequencing to profile somatic gene mutations in tumor cells. Regarding identified epigenomic abnormalities, we perform further analysis to determine whether they could be good candidates to translate into therapy development. To this end, we will modulate the activity of targets by using their activators and inhibitors in vitro and establish xenograft mouse models of hematological malignancies and manipulate their activity in vivo. Through these studies, we aim to develop new therapeutic agents or modalities that lead to improved patients��� prognosis.

  Study JGAS000603

• Transfer Learning Associates CAFs with EMT and Inflammation in Tumor Cells in Human Tumors and Organoid Co-Culture in Pancreatic Ductal Adenocarcinoma

  This study examined the transcriptional changes induced by cancer associated fibroblasts (CAFs) in pancreatic ductal adenocarcinoma patient-derived tumor organoids. We hypothesized that cancer associated fibroblasts impacted tumor cell transcription to promote tumorigenic behavior. Using patient-matched cells from 3 patients, we compared the transcriptional profiles of patient-derived organoids in monoculture to patient-derived organoids co-cultured with CAFs. Similarly, we looked at the transcriptional changes in matched patient-derived cancer associated fibroblasts grown in monoculture or co-cultured with patient-derived organoids. With a focus on intercellular crosstalk, we identified crosstalk between cancer associated fibroblasts and patient-derived organoids through VEGFA and NRP1. This was identified by bulk RNA sequencing and examined dynamically in organoid-CAF co-culture. This dbGaP deposit is the bulk RNA sequencing data for these 3 patients.

  Study phs003563

• P4HA1 Mediates Hypoxia-Induced Invasion in Human Pancreatic Cancer Organoids

  Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy defined by extensive invasion into the local tumor microenvironment and systemic metastasis. PDAC develops in a hypoxic microenvironment and adapts to survive under low oxygen conditions, including the activation of processes that may enhance the ability of cancer cells to invade locally or metastasize. Here we employ bulk RNA-sequencing of eight patient-derived organoid (PDO) cultures grown in hypoxia and normoxia to identify differentially expressed genes. PDOs were grown in Matrigel, transferred into collagen domes, then incubated in hypoxia or normoxia. Invasive organoids were individually collected from collagen domes grown in hypoxia and normoxia separately and processed for RNA-sequencing analysis. Using this dataset, prolyl 4-hydroxylase subunit alpha (P4HA1) was identified as a potential regulator of PDAC invasion in hypoxia. This dataset exists as a reference for gene expression of invasive organoids in hypoxia and normoxia.

  Study phs003961

• A proteogenomic atlas of the human neural retina

  The human neural retina is enriched for alternative splicing, and it is estimated that more than 10% of variants associated with inherited retinal diseases (IRDs) alter splicing. Previous research mainly used short-read RNA-sequencing techniques to investigate retina-specific splicing and splicing factors. However, this technique provides limited information about transcript isoforms. To gain a deeper understanding of the human neural retina and its isoforms, we generated a proteogenomic atlas that combines PacBio long-read RNA-sequencing data with mass-spectrometry and whole-genome sequencing data from three healthy human neural retina samples. About one third of the nearly 60,000 transcript isoforms were novel, and ten novel peptides that confirmed novel isoforms were detected. This study highlights the importance of studying tissue-specific transcriptomes in greater detail to better understand tissue-specific regulation and to identify disease-causing variants.

  Study EGAS50000000070

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• SARS-CoV2 mRNA-vaccination-induced Immunological Memory in Human Non-Lymphoid and Lymphoid Tissues

  This dataset includes combined single-cell RNA-Seq and T cell receptor profiling data for SARS-CoV-2 spike protein-reactive CD4+ T cells and NK cells from blood, liver, lungs, and bone marrow of human donors.

  Dataset EGAD50000000062

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from XP patients and controls as well as rescued patient hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000230

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from isogenic wild-type (WT), XPA and XPG gene knockouts hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000228