10843 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 88.07 milliseconds.

• MediMer: A versatile do-it-yourself peptide-receptive MHC class I multimer platform for tumor neoantigen-specific T cell detection

  Peptide-loaded MHC class I (pMHC-I) multimers have revolutionized our capabilities to monitor disease-associated T cell responses with high sensitivity and specificity. To improve the discovery of T cell receptors (TCR) targeting neoantigens of individual tumor patients with recombinant MHC molecules, we developed a peptide-loadable MHC class I platform termed MediMer. MediMers are based on soluble disulfide-stabilized β2-microglobulin/heavy chain ectodomain single-chain dimers (dsSCD) that can be easily produced in large quantities in eukaryotic cells and tailored to individual patients’ HLA allotypes with only little hands-on time. Upon transient expression in CHO-S cells together with ER-targeted BirA biotin ligase, biotinylated dsSCD are purified from the cell supernatant and are ready to use. We show that CHO-produced dsSCD are free of endogenous peptide ligands. Empty dsSCD from more than 30 different HLA-A,B,C allotypes, that were produced and validated so far, can be loaded with synthetic peptides matching the known binding criteria of the respective allotypes, and stored at low temperature without loss of binding activity. We demonstrate the usability of peptide-loaded dsSCD multimers for the detection of human antigen-specific T cells with comparable sensitivities as multimers generated with peptide-tethered β2m-HLA heavy chain single-chain trimers (SCT) and wild-type peptide-MHC-I complexes prior formed in small-scale refolding reactions. Using allotype-specific, fluorophore-labeled competitor peptides, we present a novel dsSCD-based peptide binding assay capable of interrogating large libraries of in silico predicted neoepitope peptides by flow cytometry in a high-throughput and rapid format. We discovered rare T cell populations with specificity for tumor neoepitopes and epitopes from shared tumor-associated antigens in peripheral blood of a melanoma patient including a so far unreported HLA-C*08:02-restricted NY-ESO-1-specific CD8+ T cell population. Two representative TCR of this T cell population, which could be of potential value for a broader spectrum of patients, were identified by dsSCD-guided single-cell sequencing and were validated by cognate pMHC-I multimer staining and functional responses to autologous peptide-pulsed antigen presenting cells. By deploying the novel CHO producer cell-based dsSCD MHC-I MediMer platform, we hope to significantly improve success rates for the discovery of personalized neoepitope- specific TCR in the future by being able to also cover rare HLA allotypes.

  Study EGAS50000000065

• Prevention and Early Treatment of Acute Lung Injury (PETAL) - Low Tidal Volume Universal Support Feasibility of Recruitment for Interventional Trial (LOTUS FRUIT) (PETAL-LOTUS FRUIT-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The two main goals of PETAL-LOTUS FRUIT were to conduct a prospective, observational study within all PETAL Network sites to determine the frequency of and outcomes from acute respiratory failure and the current usual care for tidal volume ventilation in patients with and without acute respiratory distress syndrome (ARDS), and to simulate the design and power of the proposed LOTUS trial. Background: A previous study demonstrated improved survival among patients with ARDS receiving tidal volume (Vt) targeted to 6 ml/kg of predicted body weight (PBW). As a result, low–tidal volume ventilation (LTVV) is now recommended for all patients with ARDS, although penetration of this evidence-based practice has been limited, especially early in mechanical ventilation. LTVV may also benefit patients without ARDS. Consequently, there has been increasing call to apply LTVV for all patients with acute respiratory failure upon initiation of mechanical ventilation. The PETAL Network considered performing a pragmatic stepped-wedge, cluster-randomized, controlled, hybrid implementation trial to examine systematic implementation of a default 6 ml/kg PBW LTVV strategy in patients with acute respiratory failure requiring intubation to improve adherence to LTVV and decrease mortality in acute respiratory failure. Trial planning may be better estimated by simulation than routine, simplistic calculations, but such simulations require detailed data of initial parameters. Participants: 2848 patients from 49 hospitals were enrolled. Enrollment varied by hospital, ranging from 4 to 100 patients, the maximum enrollment allowed per site. Design: PETAL-LOTUS FRUIT was a multicenter, prospective, observational cohort study of patients with acute respiratory failure on mechanical ventilation in the PETAL Network hospitals. For all patients, baseline demographic data, the hospital location, indication for intubation (hypoxemic or hypercapnic respiratory failure or both, altered level of consciousness, or surgery), type of intensive care unit (ICU), and Sequential Organ Failure Assessment score in the first 24 hours after intubation were collected. Baseline ventilator data immediately after intubation, arterial blood gas results and oxygen saturation as measured by pulse oximetry, and presence of ARDS was also collected for all patients. ARDS was defined as a ratio of arterial oxygen tension to fraction of inspired oxygen (FiO2) less than or equal to 300 with a chest radiograph within 24 hours of the qualifying ratio of arterial oxygen tension to FiO2 that had bilateral infiltrates unexplained by mass, collapse, or effusion. For the first 50 patients enrolled at each hospital, daily data on ventilator mode, Vt, and presence of ARDS for the first 3 days after intubation was collected. Vt indexed to PBW was calculated from the set Vt for patients on ventilator mode with volume settings. For patients on pressure ventilation modes, Vt was calculated from the ratio of minute ventilation (in ml/min) to the respiratory rate. Enrolled patients were followed until hospital discharge or 28 days for clinical outcomes including mortality, ventilator-free days, and length of stay. To determine the possible improvement in mortality that could be observed with a reduction in Vt from current usual care in the PETAL-LOTUS FRUIT cohort to 6 ml/kg PBW, mortality was estimated as a function of initial Vt. Five models based on data from three distinct patient populations were used. 500 simulations of a stepped-wedge, cluster-randomized clinical trial using the model with greatest predicted benefit for lowering the Vt to 6 ml/kg PBW in PETAL-LOTUS FRUIT sites were performed. Conclusions: Use of initial tidal volumes less than 8 ml/kg predicted body weight was common at hospitals participating in the PETAL Network. After considering the size and budgetary requirement for a cluster-randomized trial of LTVV versus usual care in acute respiratory failure, the PETAL Network deemed the proposed trial infeasible (PMID: 30407869).

  Study phs003791

• Idiopathic Pulmonary Fibrosis Network AntiCoagulant Effectiveness in Idiopathic Pulmonary Fibrosis (IPFNet-ACE-IPF-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The ACE-IPF trial tested the hypothesis that treatment with warfarin at recognized therapeutic doses would reduce rates of mortality, hospitalization, and declines in Forced Vital Capacity (FVC) in subjects with Idiopathic pulmonary fibrosis (IPF).Background: IPF is a chronic, progressive lung disease of unknown cause characterized by the histopathologic pattern of usual interstitial pneumonia. The median survival of patients with IPF after the onset of symptoms is 2 to 5 years. Prior animal and human studies in pulmonary fibrosis provide a compelling rationale to examine anticoagulation as a therapeutic approach in IPF. Large epidemiologic studies link IPF with thrombosis-related clinical events, such as an increased risk of acute coronary syndrome and deep vein thrombosis. The suspected causal relationship may extend beyond simple coagulation cascade-induced thrombus formation, as procoagulant enzymes may directly stimulate fibrosis via cell surface receptor - mediated responses.Participants: Patients aged 35 to 80 years with progressive IPF were potentially eligible. Progressive IPF was defined as a history of (1) worsening of dyspnea, or (2) physiologic deterioration defined as an absolute decline of either FVC greater than or equal to 10% or DlCO greater than or equal to 15%, a reduction in arterial oxygen saturation of greater than or equal to 5%, or progression of radiographic findings. Between December 14, 2009 and April 1, 2011, 145 subjects were enrolled: 72 in the warfarin group and 73 in the placebo group. The mean age for the population was 67 years. 27% of the subjects were women and 92% were white.Participants were excluded if they met any of the following criteria: current indication for, or treatment with, warfarin, prasugrel, or clopidogrel combined with aspirin; the presence of an increased risk of bleeding; a recent cerebral vascular accident or gastrointestinal bleeding; any current signs or symptoms of severe, progressive, or uncontrolled comorbid illness; and their presence on the active list for lung transplantation. Design: ACE-IPF was a double-blind, randomized, placebo-controlled trial of warfarin targeting an international normalized ratio (INR) of 2.0 to 3.0 in patients with IPF. Subjects were randomized in a 1:1 ratio to warfarin or matching placebo for a planned treatment period of 48 weeks. Study subjects were provided two strengths of warfarin tablets (1 mg and 2.5 mg) or matching placebos. Subjects measured their INR with encrypted meters at least weekly. Participants were seen at screening, baseline, and at 16, 32, and 48 weeks after enrollment. Home monitoring was validated by plasma INR measurement at the week 1 and 16 visits.The primary outcome was a composite endpoint based on the time to all-cause mortality; nonelective, nonbleeding hospitalization; or a decrease in the absolute FVC greater than or equal to 10% from baseline value. Secondary outcome measures included rates of mortality, hospitalization, respiratory-related hospitalization, acute exacerbation, bleeding, cardiovascular events, and changes over time in FVC, 6-minute walk test distance, DlCO, plasma fibrin D-dimer levels, and quality of life (QOL).Conclusions: The study did not show a benefit for warfarin in the treatment of patients with progressive IPF and was terminated due to excess mortality in the warfarin treatment group. Treatment with warfarin was associated with an increased risk of mortality in an IPF population who lacked other indications for anticoagulation.Reported causes of death indicated 11 of the 14 were respiratory-related in the warfarin group versus three of the three in the placebo group. There were also three cardiovascular deaths in the warfarin group versus none in the placebo group. No deaths were attributed to bleeding. The warfarin group also demonstrated an increased rate of combined all-cause hospitalization and all-cause mortality. (Am J Respir Crit Care Med. 2012 Jul 1;186(1):88-95.)

  Study phs004070

• Sickle Cell Disease Implementation Consortium Registry (SCDIC Registry-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions.Objectives: To understand the barriers to care and other factors related to reduced healthcare utilization after the transition from pediatric to adult SCD care which may contribute to increased morbidity and mortality.Background: Fifty years ago, it was rare for individuals with SCD to live beyond childhood. Advances in care delivery and treatment have more than doubled the life expectancy of individuals with sickle cell disease (SCD) since 1972. Beginning in the 1970s, measures such as newborn screening, prophylactic administration of penicillin, and immunization against bacterial infections decreased complications and morbidity, increasing the length and quality of life of children with SCD. Blood transfusions are currently the only proven way to prevent some of the major complications of SCD, especially recurrent stroke. They are also used frequently to help manage some of the acute complications of SCD. More recently, the use of hydroxyurea (HU) as a therapeutic agent to increase fetal hemoglobin has been shown to further reduce the debilitating symptoms of and improve survival in SCD. L-glutamine and crizanlizumab are additional treatments to reduce pain crises and voxelotor is approved to lower the risk of anemia and improve blood flow. In the absence of a widely accessible cure, treatment for SCD is usually aimed at avoiding crises, relieving symptoms, and preventing complications. Many of the advances in treatment have not translated into an increase in longevity or quality of life for adolescents and adults because of disparities in access to routine primary health care.Individuals with SCD experience a markedly increased mortality beginning in the second decade of life. The third and later decades of life are frequently associated with severe chronic pain progressive organ damage and frequent hospitalizations. The provision of evidence-based and expert opinion-based care in SCD is complicated by the difficulties that many patients experience in obtaining access to the health care system and in receiving long-term care from knowledgeable providers. A registry of 2,400 people with SCD was established to provide a rich resource to study the natural history of SCD and to understand barriers to care during the transition from pediatric to adult care. Participants: 2,438 participants with a confirmed diagnosis of SCD were enrolled into the registry over an 18-month period. At the time of enrollment, all participants were 15-45 years of age, English speaking, and without a bone marrow transplant.Design: The SCDIC Registry is a longitudinal observational cohort study. At enrollment, data collection included a medical record abstraction of clinical history, the most recent lab results, and a participant survey which included several patient reported outcomes from PROMIS, ASCQ-Me and NeuroQoL. Similar surveys were administered at annual follow-up. Four to five years after enrollment, a second record abstraction was completed with all clinical events that occurred since enrollment and another set of recent labs. There were many research questions proposed to be answered with the study data thus there was no primary outcome.Conclusions: As noted previously, there were no primary outcomes determined at the start of the study. Research questions included examination of co-morbidities, healthcare utilization, and patient reported outcomes. Key findings from the Registry include:Executive dysfunction, learning difficulties, and poor comprehension significantly associated with poor activities of daily living skills. Executive dysfunction also associated with HU non-adherence. Continuing HU after conception increased odds of miscarriage or stillbirth compared to women who were not using HU. Continuing HU after conception increased odds of low birth weight in infants. Compared to adolescents, young adults had significantly more severe pain, organ dysfunction, mental health disorders, sleep problems, and barriers to medical care. Young adults were significantly less likely to see a sickle cell specialist in the past 2 years. Females had higher pain frequency and severity, more pain episodes, anxiety, depression, hospitalizations, and higher fetal hemoglobin levels. Males had more respiratory, musculoskeletal, genitourinary, and cardiovascular complications, more skin ulcers, and more use of HU. Among 128 subjects that died during the study period, iron overload, pulmonary hypertension, and depression, were significant predictors of the risk of death in multivariate analyses.

  Study phs004203

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001060

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001108

• Somatic mutation and selection at epidemiological scale - Sanger_NanoSeq_RandD

  Bottleneck sequencing of human tissue including neurons, cord blood, sperm This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/. As we age, many tissues become colonised by microscopic clones carrying somatic driver mutations. Some of these clones represent a first step towards cancer whereas others may contribute to ageing and other diseases. However, our understanding of the clonal landscapes of human tissues, and their impact on cancer risk, ageing and disease, remains limited due to the challenge of detecting somatic mutations present in small numbers of cells. Here, we introduce a new version of nanorate sequencing (NanoSeq), a duplex sequencing method with error rates of less than 5 per billion base pairs, which is compatible with whole-exome and targeted gene sequencing. Deep sequencing of polyclonal samples with single-molecule sensitivity enables the simultaneous detection of mutations in large numbers of clones, yielding accurate somatic mutation rates, mutational signatures and driver mutation frequencies in any tissue. Applying targeted NanoSeq to 1,042 non-invasive samples of oral epithelium and 371 samples of blood from a twin cohort, we found an unprecedentedly rich landscape of selection, with 46 genes under positive selection driving clonal expansions in the oral epithelium, over 62,000 driver mutations, and evidence of negative selection in some genes. The high number of positively selected mutations in multiple genes provides high-resolution maps of selection across coding and non-coding sites, a form of in vivo saturation mutagenesis. Multivariate regression models enable mutational epidemiology studies on how carcinogenic exposures and cancer risk factors, such as age, tobacco or alcohol, alter the acquisition and selection of somatic mutations. Accurate single-molecule sequencing has the potential to unveil the polyclonal landscape of any tissue, providing a powerful tool to study early carcinogenesis, cancer prevention and the role of somatic mutations in ageing and disease.

  Dataset EGAD00001015624

• National Eye Institute (NEI) Age-Related Eye Disease Study (AREDS)

  The Age-Related Eye Disease Study (AREDS) was initially designed as a long-term multi-center, prospective study of the clinical course of age-related macular degeneration (AMD) and age-related cataract. In addition to collecting natural history data, AREDS included a clinical trial of high-dose vitamin and mineral supplements for AMD and a clinical trial of high-dose vitamin supplements for cataract. AREDS participants were 55 to 80 years of age at enrollment and had to be free of any illness or condition that would make long-term follow-up or compliance with study medications unlikely or difficult. On the basis of fundus photographs graded by a central reading center, best-corrected visual acuity and ophthalmologic evaluations, 4,757 participants were enrolled in one of several AMD categories, including persons with no AMD. The clinical trials for AMD and cataract were conducted concurrently. AREDS participants were followed on the clinical trials for a median time of 6.5 years. Subsequent to the conclusion of the clinical trials, participants were followed for an additional 5 years and natural history data were collected. The AREDS research design is detailed in AREDS Report 1. AREDS Report 8 contains the mainline results from the AMD trial; AREDS Report 9 contains the results of the cataract trial. Blood samples were also collected from 3,700+ AREDS participants for genetic research. Genetic samples from 600 AREDS participants (200 controls, 200 Neovascular AMD cases, and 200 Geographic Atrophy cases) were selected using data available in March 2005 and then were evaluated with a genome-wide scan. These data, as well as selected phenotypic data, were made available in the dbGaP. DNA from AREDS participants, which is currently being stored in the AREDS Genetic Repository, is available for research purposes. However, not all of the 3,700+ AREDS participants who submitted a blood sample currently have DNA available. In addition to including the data from the genome-wide scan on the 600 original samples, this second version of the AREDS dbGaP database provides a comprehensive set of data tables with extensive clinical information collected for the 4,757 participants who participated in AREDS. The tables include information collected at enrollment/baseline, during study follow-up, fundus and lens pathology, nutritional estimates, quality of life measures and measures of morbidity and mortality. In November 2010, over 72,000 high quality fundus and lens photographs of 595 AREDS participants (of the original 600 selected for the genome-wide scan) were made available in the AREDS dbGaP. In addition to the genome-wide scan data, the fundus and lens grading data for these participants are also available through the AREDS dbGaP. Details about the ocular photographs that are available may be found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs". In January 2012, a measure of daily sunlight exposure was added in a separate "sunlight" table. Furthermore, the "followup" table has been revised. The visual acuity for the right eye was inadvertently missing at odd-numbered visits (01, 03, 05, etc.). This data is now part of the table. In February 2014 over 134,500 high-quality fundus photographs (macular field F2) of 4613 AREDS participants were added to the existing AREDS dbGaP resource. The AREDS dbGaP image archive already contains over 72,000 high quality fundus and lens photographs of 595 AREDS participants for whom dbGaP-accessible genotype data exist. Information about the available ocular photographs found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs" has been updated with an addendum. It is hoped that this resource will better help researchers understand two important diseases that affect an aging population. These data may be applied to examination and inference on genetic and genetic-environmental bases for age-related diseases of public health significance and may also help elucidate the clinical course of both conditions, generate hypotheses, and aid in the design of clinical trials of preventive interventions. Definitions of Final AMD Phenotype Categories Please see phd001138.1 for a detailed description of how AREDS participants' final AMD phenotype was categorized. User's Guide for AREDS Phenotype Data A detailed User's Guide for the AREDS phenotype data is available. This User's Guide is meant to be a comprehensive document which explains the complexities of the AREDS data. It is recommended that all researchers using AREDS phenotype data make use of this User's Guide.

  Study phs000001

• Human Companion Data for 'A Transcriptomic Atlas of Mouse Cerebellar Cortex Reveals Novel Cell Types'

  In this study, we used single-nucleus RNA-seq to comprehensively define the cell specialization of the mouse cerebellar cortex and vermis. We focused in particular on two interneuron populations—the unipolar brush cells (UBCs) and the molecular layer interneurons (MLIs), identifying continuous variation within the former population, and a new discrete axis of variation in the latter. Human postmortem tissue was used to demonstrate that these specializations are evolutionarily conserved in primates. Together, these findings provide the first comprehensive cellular atlas of the cerebellar cortex, and outline a methodological and conceptual framework for the integration of molecular, morphological, and physiological ontologies for defining brain cell types.

  Study phs002414

• PGRN-Leducq: Identification of the KCNE1 D85N Polymorphism as a Possible Modulator of Drug-Induced Torsades de Pointes

  The goal of this study was to search for genetic variants that could be responsible for modifying the risk of drug-induced long QT syndrome (diLQTS). diLQTS is a relatively common adverse drug event and has been a leading cause for drug relabeling and withdrawal from the market. Our hypothesis, that variants in genes which regulate electrical properties in the heart modify the risk of diLQTS, was tested by genotyping patients of European descent at 1424 single nucleotide polymorphisms (SNPs) in 18 candidate genes. We found that the SNP KCNE1 D85N was highly predictive of diLQTS with an odds ratio of 9.0 (95% confidence interval: 3.5-22.9).

  Study phs000617

• A Phase II Study: CRS207/GVAX Plus Anti-PD1 and Anti-CTLA4 Recruits Mesothelin- and KRAS-Specific T cells into PDAC

  This study examined immunologic correlatives from a phase II study evaluating CRS207/GVAX vaccines in combination with anti-PD1 and anti-CTLA4 in metastatic pancreatic cancer (NCT03190265). Arm A received CRS207/GVAX with anti-PD1 and anti-CTLA4 therapy; Arm B received CRS207 with anti-PD1 and anti-CTLA4 therapy. Patients undergoing treatment in this trial had peripheral blood mononuclear cells (PBMCs) and tumor tissue biopsied serially at pre-treatment and on-treatment timepoints. Single-cell RNA/TCR sequencing was employed on PBMCs. Bulk RNA/TCR sequencing was employed on tumor tissues. We identified treatment-enriched inflammatory pathways as well as T cell repertoires.

  Study phs003798

• Proteomic Characterization of Intrahepatic Cholangiocarcinoma Identifies Risk-Stratifying Subgroups, Proteins Associated with Time-To-Recurrence, and mTOR Effector Molecule EIF4A1 as a Druggable Therapeutic Target

  Using mass spectrometry-based proteomics, we analyzed two independent cohorts comprising 80 and 62 treatment-naive ICC tumors, 67 adjacent non-malignant tissues, and 9 patient-derived xenografts (PDX). In the first cohort, we identifed two subclusters with distinct times-to-recurrence (TTR). A 4-protein classifier trained on our data cohort accurately stratifies these ICC clusters in the Dong et al. dataset (2022) and in our independent second cohort, revealing similar associations between proteomic motifs and clinical outcomes. The Translation regulator EIF4A1 emerges as a therapeutic target, as its inhibition with novel drug eFT226 significantly reduces tumor growth in an ICC PDX model.

  Study EGAS50000001343

• SCI-MAP: Single Cell Microgel embedded iPS-cells to map molecular variability of cell differentiation using a systems biology approach

  In the SCI-MAP project we will map cell states encountered across a previously established 49 day in vitro chondrogenic differentiation protocol. We do this to optimise the differentiation process for therapeutic and in vitro modelling ends. We collect epigenetic open chromatin and phenotypic transcriptome data to determine cell states and so performed single nucleus sequencing in two modalities: RNA- and ATAC-sequencing. Data was collected in a time series experiment at 7 points: Days 0, 3, 6, 8, 14, 21, and 49, starting with the first pilot data from day 21 (D21) then the actual experiment time series 1 (TS1) of days 0, 3, 6, 8, 14, and 49.

  Study EGAS50000001756

• The European Bank for Induced Pluripotent stem cells (EBiSC) is designed to address the increasing demand by iPSC researchers for quality-controlled, disease-relevant research grade iPSC lines, data and cell services.In this study Whole Genome Sequencing was performed on a selection of lines from the project.

  Induced pluripotent stem (iPS) cells have the potential to significantly advance drug development and health research, yet collections of stem cells are scattered across the world, their quality cannot always be guaranteed, and accessing them is often difficult. The goal of EBiSC is to establish a European iPS cell bank that will be the ‘go-to’ resource for the characterisation, storage and distribution of high quality iPS cells. Ultimately, EBiSC will become an independent organisation, distributing high quality iPS cells on a not-for-profit basis to scientists worldwide.

  Study EGAS00001002755

• Identification and functional characterisation of a rare MTTP variant underlying familial non-alcoholic fatty liver disease

  We identified a rare causal variant in MTTP, c.1691T>C p.I564T (rs745447480) encoding microsomal triglyceride transfer protein (MTP) causing progressive non-alcoholic fatty liver disease with cirrhosis and hepatocellular carcinoma unrelated to metabolic syndrome, without manifestations of abetalipoproteinemia, in a four generation family with South Asian ancestry. Variant-expressing hepatocyte-like-cells (HLCs) derived from human induced pluripotent stem cells generated from homozygous donor skin fibroblasts had lower lipoprotein ApoB secretion, compared to wild type cells. Cytoplasmic triglyceride accumulation in HLCs triggered endoplasmic reticulum stress, secretion of pro-inflammatory mediators, production of reactive oxygen species, delineating the progression of disease associated with homozygosity for MTTP p.I564T

  Study EGAS00001005254

• EGA submission account terms

  Submission account terms Each EGA submission account has a dedicated submission box. To ensure continued service to all submitters EGA submission boxes should not exceed 8Tb in size, and cannot exceed 12Tb. Those that are near to or exceeding this value will be monitored on a weekly basis by the helpdesk team and the submitter will be contacted and guidance provided accordingly on completing their metadata registration. You will be able to register your metadata associated with the files in your submission account via EGA Submitter Portal, Webin or the EGA REST API. EGA also requests that metadata is submitted within 60 days of upload data to a submission box. When we detect files that are over 60 days old in a submission box we will notify the submitter requesting that metadata be submitted or the files removed from the submission box. It is important to note that data is not archived at the EGA until the metadata describing the files has been associated and the archival process has completed. It is only when associated metadata has been submitted that the archival process into EGA is fully triggered. EGA removes files from the submission box once they have been successfully archived, so no action is required by a submitter to remove successfully archived files. Files over 90 days old will be deleted from the submission box unless EGA Helpdesk has been contacted and confirmed an exemption with the submitter.

  Documentation submission/terms

• 33 patients with Monoclonal Gammopathy of Undetermined Significance (MGUS)

  Monoclonal gammopathy of undetermined significance (MGUS) is a premalignant precursor of multiple myeloma (MM) with a 1% risk of progression per year. Although targeted analyses have shown the presence of specific genetic abnormalities such as IGH translocations, RB1 deletion, 1q gain, hyperdiploidy or RAS genes mutations, little is known about molecular mechanism of malignant transformation. We have performed whole exome sequencing together with SNP array analysis in 33 flow-cytometry separated abnormal PC samples of MGUS patients to describe somatic gene mutations and chromosome changes at the genome-wide level. Non-synonymous mutations (NS-SNVs) and copy number alterations (CNAs) were present in 97.0% and in 63.6% of cases, respectively. Importantly, the number of somatic mutations was significantly lower in MGUS compared to MM (p<10-4) and we have identified 6 myeloma significantly mutated genes which are KRAS, NRAS, DIS3, HIST1H1E, EGR1 and LTB in the MGUS dataset. We also found a positive correlation with increasing chromosome changes and somatic mutations. IGH translocations were present in 27.3% of cases comprising t(4;14), t(11;14), t(14;16) or t(14;20) and were in a similar frequency to MM, which corresponded with primary lesion hypothesis. Data from this study showed MGUS is a genetically comprehensive disease, however overall genetic instability is significantly lower compared to MM.

  Dataset EGAD00001001901

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234