10666 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 19.16 milliseconds.

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells - sc

  KIR+NKG2A- Natural Killer (NK) cells have the unique ability to detect downregulation of single HLA-I allotypes, frequently occurring in malignantly-transformed and virus-infected cells in order to escape T cell recognition. We have recently shown that circulating Innate Lymphoid Cells 1 (cILC1) have the potential to generate such KIR+NKG2A- NK cells but their developmental origin was unknown. Here we demonstrate that the development of cILC1 is thymus-dependent and identify a putative progenitor of cILC1s in the thymus, called thyILC1. Single-cell RNAseq analysis revealed a close relationship of thyILC1s to CD34+ double-negative (DN) thymocytes, but in contrast to DNs, thyILC1s had lost T cell differentiation potential. However, like cILC1s they could be efficiently differentiated into KIR+NKG2A- NK cells. thyILC1s strongly expressed RAG1/2, PTCRA (preTCR, and NOTCH1/3, but lacked expression of TCR chains, suggesting that they failed to pass the -selection checkpoint of thymocyte development. Finally, analyses of patients with FOXN1het deficiency, showing thymic hypoplasia due to lack of mature thymic epithelial cells, exhibited a profound deficiency of cILC1s but not cILC2s and cILC3s, demonstrating thymus dependency of cILC1s. Together, the data suggest that thyILC1s are the source of a novel thymus-dependent NK cell differentiation pathway that promotes generation of KIR+NKG2A- NK cells.

  Study EGAS50000000790

• What is metadata?

  What is metadata? Data represents units of information and metadata can be seen, simply put, as data about other data. For example, in a simple experiment in which a patient genome was sequenced, there are multiple and diverse fields of metadata: from the biological sex of the patient to the sequencing platform used. Another way to understand metadata, following our genomic experiment example, is going through the different layers of (meta)data: One of the basic units of information (data) would be the sequence of nucleotides (e.g. GCTGG and GCCGG). This DNA sequence can be contextualised within a chromosome by providing its locus (e.g. β-globin gene). This data, the locus, is about other data, the sequence of nucleotides, which would render it metadata. We can go one step further, and provide more context, by giving the associated phenotype of each of these sequences: GCTGG corresponds to a healthy individual, while GCCGG corresponds to a person with β-thalassaemia. Once again, this data is contextualising the data we have provided up to this point, which makes it metadata. With this simple example, what we are doing is adding layers of data that describe the ones below. Had we given the sequences alone, little would be possible from the researchers' point of view. But, now that the data has its accompanying metadata, a researcher could compare both sequences and their phenotypes to infer a possible cause of the disorder. Each layer of information broadens the possible applications of the data. Now that we know what metadata is, it is time to emphasise the importance of submitting good quality metadata. The quality of the metadata will determine whether the data is usable, discoverable, and interpretable by researchers and clinicians. One example that highlights the importance of good quality metadata is the description of biological sex of a patient: while the terms "female," "girl," or "woman" all represent the same concept, they are not harmonised. These different representations of a concept can create confusion and errors in data analysis. By applying standard definitions and terminologies to biological sex metadata, we can avoid misunderstandings and facilitate the integration of different datasets.  In order to comply with the FAIR principles and, more specifically, to allow for the (meta)data to be interoperable (i.e. used universally and unambiguously), we need to place some standards onto the (meta)data EGA  archives. These can be as simple as asserting that the given patient's biological sex is one of the correct terms (e.g. female or male); or as complex as multiple layers and combinations of validation steps with existing records. You can find further details on how EGA manages these standards on our metadata model page.

  Documentation submission/metadata/what-is-metadata

• A Cancer Cell-Line Titration Series for Evaluating Somatic Classification

  Accurate detection of somatic single nucleotide variants and small insertions and deletions from DNA sequencing experiments of tumour-normal pairs is a challenging task. Tumour samples are often contaminated with normal cells confounding the available evidence for the somatic variants. Furthermore, tumours are heterogeneous so sub-clonal variants are observed at reduced allele frequencies. We present here a cell-line titration series dataset that can be used to evaluate somatic variant calling pipelines with the goal of reliably calling true somatic mutations at low allele frequencies. Cell-line DNA was mixed with matched normal DNA at 8 different ratios to generate samples with known tumour cellularities, and exome sequenced on Illumina HiSeq to depths of >300x. The data was processed with several different variant calling pipelines and verification experiments were performed to assay >1,500 somatic variant candidates using Ion Torrent PGM as an orthogonal technology. By examining the variants called at varying cellularities and depths of coverage, we show that the best performing pipelines are able to maintain a high level of precision at any cellularity. In addition, we estimate the number of true somatic variants undetected as cellularity and coverage decrease. Our cell-line titration series dataset, along with the associated verification results, is effective for this evaluation and will serve as a valuable dataset for future somatic calling algorithm development.

  Study EGAS00001001016

• Double mutant DNMT3A AML: a unique subtype

  Mutation of DNMT3A, encoding a de novo methyltransferase essential for cytosine methylation, is a common early event in clonal hematopoiesis (CH) and adult acute myeloid leukemia (AML). Spontaneous deamination of methylated cytosines damages DNA, which is repaired by the base excision repair (BER) enzymes MBD4 and TDG. Congenital MBD4-deficiency has been linked to early-onset CH and AML, and is marked by exceedingly high levels of DNA damage and mutation of DNMT3A. Strikingly, wildtype (WT) DNMT3A binds TDG, thereby potentiating its repair activity. Since TDG is the only remaining BER enzyme in MBD4-deficient AML patients capable of repairing methylation damage, we investigated whether mutant DNMT3A negatively affects the repair function of TDG. We found that, whereas WT DNMT3A stimulates TDG function, mutant DNMT3A impairs TDG-mediated repair of DNA damage in vitro. In light of this finding and to extrapolate our observations to the broader AML patient population, we investigate here the genetic profiles and survival outcomes of AML patients with single (SM) versus double mutant (DM) DNMT3A. DM DNMT3A AML patients show a characteristic driver mutation landscape and reduced overall survival when compared to SM DNMT3A AML patients. Importantly, whole-genome sequencing showed a trend for increased DNA damage in primary DM DNMT3A AML samples, especially when DNMT3A mutations are located at the DNMT3A-TDG interaction interface.

  Study EGAS00001007966

• GoT2D: Genetics of Type 2 Diabetes, a study of the the genetic architecture of type 2 diabetes using low pass whole genome sequencing and high density SNP genotyping in 2,657 individuals.

  The Genetics of Type 2 Diabetes Consortium (GoT2D) is a collaboration between the University of Michigan, the Broad Institute and the Wellcome Trust Centre for Human Genetics. The overall aim is to extend upon recent efforts, such as genome-wide association studies (GWAS) and large scale meta-analyses. While they have proved successful at mapping genomic loci that influence human diseases, like type 2 diabetes, much of the heritability remains unexplained. In this study, we use next generation sequencing and genotyping technologies to query for lower frequency variants in the human genome. Thereby, allowing a deeper characterization of the spectrum of alleles associated with type 2 diabetes risk, and a better assessment of the genes that play a role in the etiology of type 2 diabetes development. We studied 1,326 T2D cases and 1,331 normoglycemic controls from Northern and Central Europe (Sweden, Finland, UK, and Germany). To efficiently characterize the entire genome sequence of each individual, we performed low-coverage (~5x) whole-genome sequencing, augmented by deep coverage (~100x) sequencing of the exome, and dense (2.5M) single nucleotide polymorphism (SNP) genotyping using the HumanOmni2.5 array. The data deposited in EGA will include all the Swedish, Finnish, UK, and German samples.

  Study EGAS00001001459

• Glioblastoma epigenome profiling identifies SOX10 as a master regulator of molecular tumour subtype

  Glioblastoma in adult patients are classified into four subtypes, IDH, MES, RTK I, and RTK II, based on DNA methylation and RNA expression data. Tumour subtype transitions commonly occur during the treatment of glioblastoma patients, and transitions to the mesenchymal (MES) subtype have been associated with therapy resistance and adverse prognosis. Here, we generate DNA methylome and histone modification data of glioblastoma primary tumours and show that glioblastoma subtypes differ by their enhancer landscapes. Using Core Regulatory Circuitry analysis of H3K27ac data, and independent analysis of RNA-derived gene regulatory networks, we identified 38 subtype master regulators whose cell type-specific activities we mapped in single-cell RNA sequencing data. These analyses identified the chromatin modifier SRY-Box 10 (SOX10) as a master regulator in tumours of the RTK I subtype. In functional studies we demonstrate that SOX10 loss causes a transition of RTK I tumour cells to a mesenchymal cellular state by altering the accessibility of enhancer-rich chromatin regions and their occupancy by Bromodomain Containing 4 (BRD4), a dynamic constituent of super-enhancers. Treatment with the BRD4 inhibitor JQ1 blocked this transition. These data demonstrate the fundamental role of enhancer chromatin remodelling and master regulator activity in the establishment, maintenance and plasticity of glioblastoma cellular states. We also make our data publically browsable at https://dkfz-b060.github.io/gb_browse/

  Study EGAS00001003953

• A Platform Study of Combination Immunotherapy for the Neoadjuvant and Adjuvant Treatment of Patients with Surgically Resectable Adenocarcinoma of the Pancreas

  This is a single-institutional, randomized, open label platform clinical trial testing various immunotherapy combinations. Patients with newly diagnosed and surgically resectable pancreatic ductal adenocarcinoma (PDA) and scheduled to undergo the Whipple procedure at Johns Hopkins Hospital were eligible to participate in this study. Criteria for determining resectability strictly followed National Comprehensive Cancer Network (NCCN) guidelines. The study consisted of 6 parts: parts 1-5 constituted the Prime Phase (see below), and part 6 was the Extended Treatment Phase. Part 1: Participants received one cycle of immunotherapy two weeks prior to undergoing the Whipple procedure. Part 2: Subjects underwent the Whipple procedure. Part 3: Subjects received a second cycle of immunotherapy 4-10 weeks following the Whipple procedure (2-4 weeks prior to adjuvant chemoradiation). Part 4: Subjects underwent chemoradiation. Part 5: Subjects received 4 additional 28-day cycles of immunotherapy beginning 1-2 months after completing chemoradiation for a total of six cycles (two before chemoradiation and 4 following chemoradiation). Eligible subjects were randomized to Arms A and B in a 1:1 ratio, stratified up-front by age (≤65, >65). Arm A participants received Cy/GVAX. Arm B participants received the combination of Cy/GVAX and nivolumab. GVAX Vaccine consists of equal numbers (2.5 x 108 each) of Panc 6.03 pcDNA1GM-CSF and Panc 10.05 pcDNA1GM-CSF combined into a single vaccination. Each vaccination consisted of six total intradermal injections. A single intravenous (IV) dose of 200 mg/m2 Cy (CytoxanR) was given one day prior to GVAX. Anti-PD-1 Therapeutic Antibody Nivolumab 480 mg every 4 weeks was administered as an intravenous infusion. The primary objective for Arms A and B was to compare IL17 expression (Th17) in vaccine-induced lymphoid aggregates between resected PDAs from patients treated with the combination of Cy/GVAX and anti-PD-1 blockade antibody vs. the treatment of Cy/GVAX alone. Secondary objectives were to assess the safety, overall survival (OS), and disease free survival (DFS) of patients treated with each of the study drug combinations, and to assess the effects of each of the immunotherapy study drug combinations on PD-L1/PD-1 associated pathways, vaccine-induced immune regulatory signatures, and peripheral and intratumoral antigen specific T cell responses. The exploratory objective was to explore the effects of therapy on tumor and peripheral blood and tumor infiltrating immune cells, and to explore potential molecular determinants of response, progression and disease stability. To these ends, tumor infiltrating immune cells (TIICs) were obtained from surgically resected tumors following the neoadjuvant treatment of the study immunotherapy. TIICs were sorted into CD3+CD4+ T cells, CD3+CD8+ T cells, CD3-CD19+ B cells, and CD3-CD19-CD11b+ myeloid cells by flow cytometry. The sorted immune cell subtype pellets were sent to the commercial vendor (Eurofins) for RNA extraction and sequencing. SMART-seq v4 Ultra Low Input mRNA Sample Prep Kit was used for library preparation with 100bp paired end reads. FASTQ files, that were returned from the vendor, are deposited here.

  Study phs003002

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• HV31 - De novo assembly of eight immune system regions

  De novo assembly of eight immune system regions for individual HV31, generated using a multi-platform pipeline. A full description of the generation of these assemblies can be found at https://doi.org/10.1101/2021.02.03.429586.

  Dataset EGAD00001007050

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Genome-Wide Association Study of Anorexia Nervosa (Price Foundation, Klarman Family Foundation, Center for Applied Genomics at the Children's Hospital of Philadelphia, Scripps Translational Sciences Institute Clinical Translational Science Award)

  Twin studies are consistent with substantial heritability in anorexia nervosa (AN), although detecting and confirming individual risk alleles has been difficult, due to small effects of single alleles and limited samples in prior studies. Methods: 1105 AN DNA samples obtained in a multisite study and 3733 pediatric patients of normal body weight were genotyped using the Illumina 610Q chip at The Center for Applied Genomics at The Children's Hospital of Philadelphia. Cases and controls were of European ancestry. Single nucleotide polymorphism (SNP) genotypes were subjected to quality control procedures, including elimination of SNPs with: call rates < 95%, minor allele frequency < 5%, and if Hardy-Weinberg equilibrium testing yielded p < 0.0001. Samples were removed if not of European ancestry or if showing cryptic relatedness. Eight AN DNA samples were deleted for low call rate, and 51 AN samples were deleted for cryptic relatedness. The statistical program, PLINK, was used to calculate a P value for each SNP passing quality control using the Cochran-Armitage trend test. The PennCNV program was used to define copy number variation (CNV). Results: We performed a genome-wide association study (GWAS) using with 1033 AN cases and 3733 controls (genomic inflation factor = 1.08). There were 11 SNPs with P<1X10-5 [(rsID, chromosome location, nearest gene, distance to nearest gene (base-pair), P value) rs6959888, 7q21.13, ZNF804B, 0, 1.63E-06; rs17725255, 20p11.23, CSRP2BP, 39396, 1.72E-06; rs10494067, 1p13.3, NTNG1, 0, 5.83E-06; rs2383378, 14q12, AKAP6, 0, 6.41E-06; rs410644, 5q14.1, SSBP2, 40462, 6.74E-06; rs4479806, 5p14.1, CDH9, 156926, 7.79E-06; rs957788, 13q33.3, FAM155A, 0, 8.11E-06; rs830998, 2q31.1, LRP2, 0, 8.68E-06; rs6782029, 3p25.3, VGLL4, 0, 9.04E-06; rs512089, 9p21.3, ELAVL2, 47984, 9.85E-06; rs3808986, 11q24.3, APLP2, 29217, 9.92E-6]. CNV analyses were performed on 1015 AN cases and 3532 controls. Overall frequencies of common or rare CNVs were similar between cases and controls. Specific rare and large (>500 kb, <1%) CNVs of interest included deletion of a large (~1.4Mbp) region of chr13q12 found in 2 AN samples and at a 10 fold lower frequency in a large sample (72,918) of subjects containing the genes SGCG, SACS, TNFRSF19, MIPEP, PCOTH, C1QTNF9B, SPATA13, MIR2276, and C1QTNF9, and an overlapping deletion and a duplication observed in 3 AN samples overlapping the CNTN6 and CNTN4 genes. Partially overlapping ~ 30 kb duplications were seen in 12 AN cases and in 1 control at the CDC5L gene on chromosome 6. Partially overlapping deletion of the 3' half of the PSTPIP1 gene was seen in 5 AN cases and no controls. Finally, a ~ 60 kb deletion of the PLEC1 gene was observed in 5 AN cases and in none of 3532 controls. Discussion: This is the first GWAS of AN. These preliminary results are consistent with absence of a major gene effect in AN. These results are consistent with genetic risk conveyed by multiple common alleles of small effect, as well as some uncommon CNVs of potentially larger effect. None of the implicated genes has a clear role in eating behavior. It must be emphasized that these results are preliminary and an additional ~ 400 AN cases will be analyzed as time and resources permit. These results require confirmation through study of independent populations of AN women.

  Study phs000679

• CIDR, NCI, NIDA Sequencing of Targeted Genomic Regions Associated with Smoking

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and Genetic Study of Nicotine Dependence in African Americans (AAND; PI: Laura Bierut and Eric Johnson). The majority of the COGEND subjects included in the current study overlap with the two datasets already available on dbGaP. GWAS data are available for COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. GWAS data are available for additional COGEND subjects through The Genetic Architecture of Smoking and Smoking Cessation, dbGaP study accession phs000404. The overall goal of this project is to apply deep sequencing to key genomic regions associated with nicotine dependence in order to accelerate the discovery of variation in molecular pathways that govern the development of nicotine dependence. The sample includes unrelated cases and controls of European American and African American descent. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerstrom Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND<2). By selecting controls who smoked cigarettes, we focus on those genetic effects that are specific to the development of nicotine dependence. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal was to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design was a community based case-control study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. AAND: AAND was initiated in 2009 to identify and characterize genetic determinants of nicotine dependence in a large African American population. Community-based recruitment of approximately 100,000 people was conducted to ascertain 1,000 African American nicotine dependent cases and 1,000 African American non-dependent, smoking controls. All subjects were between the ages of 25-44. Subjects were screened by telephone; if they qualified as a case or control, they completed the same interview that was used in COGEND and donated a blood sample. Both studies (COGEND and AAND) included measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment using the Semi-Structured Assessment for the Genetics of Nicotine Dependence. Information on nicotine dependence, as assessed by the Fagerstrom Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). All subjects were assessed in person by trained research assistants.

  Study phs000813

• National Cancer Institute (NCI) Adding Hispanics to Ongoing GWAS in Colorectal Cancer

  Genome-wide association studies (GWAS) of colorectal cancer (CRC) have been instrumental in identifying a number of common susceptibility loci in Non Hispanic (NH)-White populations, and a NCI priority is to extend GWAS findings to other populations to address racial/ethnic disparities in cancer susceptibility. Currently, GWA studies of CRC in NH-Whites, Japanese and African-Americans are ongoing. We propose a complementary study to address this critical research area in Hispanics. Hispanics represent the fastest growing ethnic population in the U.S. and have been largely understudied in terms of genetic susceptibility to cancer. There are noted differences in incidence, survival and mortality in CRC by ethnic/racial groups. Hispanics often present with CRC at a younger age and have a significantly greater incidence of stage IV tumors or metastatic disease compared to NH-Whites. We propose to conduct a large, cost-efficient, population-based GWAS in Hispanics by building upon existing NIH-funded resources, the Colon Cancer Family Registry (Colon CFR) and the Multiethnic Cohort Study (MEC). We plan to recruit 2,500 Hispanic men and women diagnosed with CRC between 01/2008 to present using cancer registries in California, physican referrals and familial referrals. Risk factor/diet questionnaires, pathology reports, Oragene saliva samples (for genotyping), optional blood samples (for genotyping and biometric analysis) and tumor blocks (for MSI testing) will be collected using methodologies developed in the Colon CFR/MEC. Cases of CRC in the MEC (currently 473; anticipated 600 at end) will also be included. Population-based Hispanic individuals without a diagnosis of CRC participating in other GWA studies in the MEC (n=3,900, U01HG004726, Haiman) will be used as controls. We will genotype all 3,100 cases using the Illumina 1M array and use available genotype and epidemiologic data collected on 3,900 controls. Our statistical analyses will include: single-SNP and haplotype effects, gene-environment interactions and heterogeneity by MSI, tumor subtype and family history of CRC. We will replicate findings in a second-stage using CRC cases and controls from Mexico (1,000 cases and 1,000 controls, EU FP7 funding, CHIBCHA, Carvajal-Carmona/Tomlinson). We will also examine heterogeneity of the risk estimates by ethnicity/race by leveraging GWA data on NH-Whites (2,142 cases, 1,909 controls, U01 CA122839, Casey), (4,000 cases, 6,000 NH-White controls, UK-CHIBCHA, Tomlinson), Colombians (2,000 cases and 2,000 controls, CHIBCHA), Japanese (1,000 cases and 1,000 controls) and African-Americans (1,500 cases and 1,500 controls, R01CA126895, Le Marchand). We will genotype replicated significant SNPs in our main and combined analysis in several Hispanic populations (note: studies funded by EU or NIH for data collection but not GWAS), including 800 Puerto Ricans, 2,000 Brazilians, 2,000 Argentineans and 3,000 Spanish/Portuguese, to assess generalizability of findings. We will examine the differences in inflammatory gene transcription dynamics in leukocytes (from blood sample collection) by fatigue level (as assessed from study questionnaire data). This study will have a high impact by addressing the key question of racial/ethnic disparities related to genetic susceptibility to CRC, will provide translational guidelines on biological mechanisms during the cancer survivorship period to increase quality of life among cancer survivors, and will enable further growth and investment into research among Hispanics by providing a resource of genetic data and biospecimens, which is lacking.

  Study phs001193