19072 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 45.19 milliseconds.

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003673

• Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003669

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003657

• Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003016

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003012

• Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003011

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003005

• Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient

  Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003017

• Genome and transcriptome sequence data from a carcinosarcoma of the uterus patient

  Genome and transcriptome sequence data from a carcinosarcoma of the uterus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002995

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002595

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• scRNA-seq and scTCR-seq from 7 MF patients

  Dataset containing scRNA and scTCR sequencing of 7 patients with cutaneous T cell lymphoma. Sequencing was performed on Illumina NextSeq 550, HiSeq 4000 and NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD50000000332

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• thraruk-G-1

  Resolving the Genetic Architecture of Aseptic Loosening After Total Hip Replacement

  Dataset EGAD00010001289

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Mutation analysis of 77 genes in cfDNA from metastatic CRC patients

  Aligned NGS data (BAM) of 77 frequently mutated genes in cancer using the AVENIO Expanded platform.

  Dataset EGAD00001010294

• Paired WGS samples (tumor and control) of one Sarcoma case

  Paired WGS samples (tumor and control) of one Sarcoma case. The paired sequencing was done on Hiseq X Ten with Illlumina TruSeq Nano DNA.

  Dataset EGAD00001010277

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• RNA-Seq of chronic lymphocytic leukemia

  398 runs and 184 samples of CLL paired RNA-Seq. Sequences were prepared with the Illumina TruSeq RNA Kit. Paired sequencing was done on Hiseq2000 or Hiseq2500.

  Dataset EGAD00001009637

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993

• RNA-seq explants chondrocytes

  Osteochondral explants were obtained from knee joints (n=17 explants) from the RAAK study. Paired-end 2x150 bp RNA sequencing (Illumina TruSeq mRNA Library Prep Kit, Illumina HiSeq X) was performed.

  Dataset EGAD00001008752

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• 17 skin and oral epithelial bulk samples from 2 donors

  Aligned BAM files with removed duplicate reads of targeted sequencing data (exomes of a panel of 153 genes) from 12 skin and 5 oral epithelial bulk samples from 2 donors. Sequences generated by the BGI DNB-SEQ platform.

  Dataset EGAD00001008956

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• RNA-Seq data of VDH15 cells with and without deletion of NSUN3

  paired RNA-Seq data of VDH15 cells with and without deletion of NSUN3. The 11 samples were sequenced on HiSeq 4000 and prepared with SmarTer low input RNA and Chip NEBNext kit.

  Dataset EGAD00001006560

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Whole exome sequencing of 3 primary Plasma Cell Leukemia samples

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 3 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001005306

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323

• In vitro mutational load

  Clonally expanded human pluripotent and adult (liver + intestine) stem cell clones were subjected to whole genome sequencing to determine the mutational impact of in vitro culture

  Dataset EGAD00001004104

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• Hepatocellular adenomas samples

  Whole exome sequencing data from 30 donors (46 tumors and 30 non-tumoral whole exome sequencing, paired-end, HiSeq 2000, Illumina) collected by the Inserm U674, PI Jessica Zucman-Rossi - Institut National du Cancer (INCa), PI Fabien Calvo, France.

  Dataset EGAD00001000737

• PMBCL sequencing - bam analysis

  Files associated with the dataset: HS1626.bam, HS1484.bam, HS1483.bam, HS1482.bam, HS1481.bam, HS1480.bam, HS1479.bam, HS1478.bam, A13805.bam, A13800.bam, A13799.bam, A05253.bam, A05252.bam, A13806.bam

  Dataset EGAD00001000692

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• Uveal melanoma whole genome sequencing, SNP arrays and RNA-seq

  We conducted whole genome sequencing and DNA SNP array of 12 uveal melanoma genomes and their matched DNA from blood. We also conducted RNA-seq of the 12 tumour samples.

  Dataset EGAD00001000372

• SNP arrays for chemotherapy response project

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). Illumina SNP arrays (760k markers) were performed using DNA from 49 tumors and associated germline DNA (49x median coverage). Data provided here consist of 98 files.

  Study EGAS00001004519

• Transcriptomic predictors of survival for palbociclib + endocrine therapy vs. capecitabine in aromatase inhibitor-resistant breast cancer from GEICAM/2013-02 PEARL

  We examined transcriptomic tumor features associated with survival from GEICAM/2013-02 PEARL, a phase III trial of palbociclib + ET vs. capecitabine in aromatase inhibitor-resistant HR+/HER2- MBC. PAM50 intrinsic subtype predicted PFS differences between palbociclib + ET and capecitabine, and lower B-cell-associated gene expression predicted longer OS with palbociclib + ET vs. capecitabine. These features may help identify HR+/HER2- tumors resistant to further ET-based treatment with CDK4/6 inhibitors.

  Study EGAS00001008177

• Longitudinal single-cell transcriptomic study in patient-derived xenografts of pediatric T-ALL

  In this study, we conducted single cell full length total RNA sequencing (VASA-seq) on 13 matched pediatric T-ALL PDX samples at initial diagnosis and relapse, along with 5 non-relapsing PDX samples collected at initial diagnosis. We identified a subpopulation of T-ALL cells with stem-like cell features that expands substantially at relapse indicating resistance to first-line therapy. Chemotherapy resistance was further validated through functional testing: Two samples were subjected to in-vitro drug testing, treated with Cytarabine for three days, followed by single-cell transcriptomic analysis using 10x Genomics. Additionally, in-vivo drug testing was conducted on one sample, involving re-engraftment into mice and treatment with a combination of Vincristine, Doxorubicin, and Dexamethasone. Single-cell transcriptomic analysis using 10x Genomics was performed after 0, 15 and 30 days of treatment.

  Dataset EGAD50000000831

• cfMethyl-Seq

  cfMethyl-Seq libraries were generated for 479 cfDNA samples and were sequenced with 150 bp paired-end reads.

  Dataset EGAD00001009003

• Leiomyosarcoma Whole Genome Sequencing

  DNA was extracted from fresh frozen LMS material for 29 untreated tumors (24 primary tumors, 5 metastatic 13 relapses) and 13 tumors treated with radiation (7 primaries, 6 metastatic relapses). DNA from matched blood was used as a normal reference. Whole-genome sequencing was performed using established protocols on Illumina instruments.

  Dataset EGAD00001007722

• ICGC PCAWG Dataset: PACA-CA_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PACA-CA.

  Dataset EGAD00001003162

• ICGC PCAWG Dataset: OV-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: OV-AU.

  Dataset EGAD00001003227

• BC Cancer, part of the Provincial Health Services Authority, Technology Development Office, Data Access Committee (PHSA TDO DAC)

  Access to data generated by BCCA is made available by completing the data access agreement for review by the data access committee and will be granted to qualified investigators for appropriate use.

  Dac EGAC00000000011

• The Transcriptomic Landscape of Oncogenic PI3K Reveals Key Functions in Splicing and Gene Expression Regulation

  This study includes RNA-seq of paired tumor biopsies from PIK3CA-mutated breast cancer patients that underwent treatment with PI3Kα inhibitors.

  Study phs002840

• Genomics analysis of mucinous tumours of the ovary and related neoplasms

  To perform genetic and gene expression analyses on mucinous ovarian tumours to determine a progression model, cell of origin and novel therapeutic targets.

  Study EGAS00001003545

• Targeted sequencing data on sequential liquid biopsy samples from mCRPC patients receiving cabazitaxel

  Sequencing data from mCRPC patients receiving cabazitaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from baseline, on-treatment and progression samples taken on cabazitaxel were sequenced as well as patient match WBC DNA

  Dataset EGAD50000001840

• Single cell multi modal dataset of bone marrow samples from follicular lymphoma patients at diagnosis et one year post treatment

  This dataset contains transcriptome, BCR, TCR and HTO data at the single cell level from follicular lymphoma bone marrow samples at diagnosis (n=19) and one year post rituximab therapy (n=16).

  Dataset EGAD50000001843

• Clonal_analysis_Bcell_activation

  We developed a B cell stimulation protocol that allowed us to expand a smaller number of naive B cells in culture (2,000 B cells at day 0). On day 6, we performed single-cell RNA-and BCR-sequencing on the entire culture, preserving both clonal diversity and size.

  Dataset EGAD50000002114

• Human embryonic stem cells dopaminergic neurons scRNA-seq

  The dataset includes 2 samples of Single cell RNA-seq (10X Genomics) from Human Embryonic stem cells. 2 samples with 2 replicates of timepoints 17 and 28 of dopaminergic neuron differentiation.

  Dataset EGAD50000001592

• Melanoma transcriptomic data from patients undergoing immunotherapy

  This dataset contains raw RNA sequencing data from melanoma patient tumor samples collected before and during immunotherapy. The data support investigation of treatment-related changes in tumor cell populations. Samples were analyzed as part of a study exploring cellular responses to immune-based therapies.

  Dataset EGAD50000001569

• Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant

  Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant. The Panel was designed using Agilent SureDesign on SureSelect XTHS Hybrid Capture Panel. Sequencing was done on Illumina NovaSeq 6000

  Dataset EGAD50000001548

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from Multiple sclerosis patients

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of six Multiple sclerosis (MS) patients.

  Dataset EGAD50000001233

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• Whole Exome Sequencing Data of 34 indolent primary renal B-Cell lymphoma cases

  Here, 34 iNHL samples were sequenced using whole exome sequencing to describe the mutational landscape of indolent primary renal B-Cell lymphomas. Mutational profiles were compared to other Marginal Zone Lymphomas.

  Dataset EGAD50000001136

• Exome - Uveal Melanomas

  Whole exome sequencing on 11 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the SureSelectXT2 Clinical Research Exome V2 kit (Agilent, 5190-9500 and G9621B). Paired-end libraries (2 x 100 bp) were sequenced on HiSeq 2000/2500 or NovaSeq 6000 instruments (Illumina).

  Dataset EGAD50000000767

• Spatial transcriptomics of hepatoblastoma

  10X Genomics Visium Spatial transcriptomics analysis of hepatoblastoma and adjacent normal liver. Spatial data of normal liver and PT2 (fastq files), and and PT13, PT14 and PT16 (bam files) using the Visium Spatial Gene Expression Solution. All samples, except PT13, were collected post-chemotherapy.

  Dataset EGAD50000000797

• DELFI low-coverage WGS of plasma cfDNA

  The dataset "DELFI low-coverage WGS of plasma cfDNA" includes paired FASTQ files produced by WGS of 689 plasma cfDNA samples from 153 patients with colorectal cancer. WGS (100bp PE) was performed on a NovaSeq 6000 with a target depth of coverage of 8x.

  Dataset EGAD50000000630

• Whole Exome Sequencing Data of prDLBCL

  We used sequenced 34 prDLBCL samples using whole exome sequencing (WES) data to evaluate possible mutational signatures and driver mutations associated with the patient’s clinical and cytogenetic characteristics.

  Dataset EGAD50000000591

• Variants Derived From Kids Heart BioBank TOF Probands (Australia)

  Short variants identified in 245 TOF probands enrolled through the Kids Heart BioBank (Australia).

  Dataset EGAD50000000839

• Variants Derived From CONCOR Biobank TOF Probands (Netherlands)

  Short variants identified in 125 TOF probands enrolled through the CONCOR Biobank (Netherlands).

  Dataset EGAD50000000837

• Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors -Additional Dataset

  Paired whole genome and exome sequencing of tumor-control pairs of Thymic epithelial tumors, additional samples with paired fastq files, sequenced on Illumina-HiSeq_X_Ten and using the Illumina_TruSeq_Nano_DNA kit.

  Dataset EGAD50000000325

• Longitudinal WES data from MEMORI trial

  70 bam files generated from deep whole exome sequencing from samples from oesophageal adenocarcinoma from 17 patients. 17 bam files generated from deep whole exome sequencing from matching blood (germline control) from patients with oesophageal adenocarcinoma. Samples were collected within the clinical MEMORI trial.

  Dataset EGAD50000000355

• Genomic analyses (WES, RNAseq, scRNAseq and scTCRseq) of triple negative breast cancer evolution

  This study explores the evolution of tumor and blood immune microenvironment and related mechanisms that shape breast cancer progression.

  Dataset EGAD50000000117

• EBNA2 ChIP-Re-ChIP in primary B-cells infected with EBV virus

  EBNA2 ChIP-Re-ChIP in primary bulk B cells 4 days post EBV-infection with B95-8. DNA binding elements of the viral master regulator EBNA2, EBNA2-CBF transcription factor complex or EBNA2-EBF1 transcription factor complex were analyzed to identify virally targeted genes.

  Dataset EGAD50000000301

• Single-cell TCR sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell TCR sequencing data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 9 LN and 16 PB samples of 14 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000403

• Single-cell RNA sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell count data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 9 LN and 16 PB samples of 14 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000402

• Single-cell BCR sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell BCR sequencing data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 5 LN and 1 PB samples of 5 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000400

• WES and RNA-Seq of HCC biopsies and HCC derived Organoids

  We aimed to identify somatic mutations and transcriptional differences that could explain the resistance to Doxorubicin. This dataset includes RNA-Seq of HCC biopsies and Organoids and WES of Organoids.

  Dataset EGAD50000000060

• Illumina Infinium MethylationEPIC Array IDAT files generated from 11 glioma patient samples

  This dataset includes IDAT files from 6 IDH-mutant, 5 IDH-wild-type glioma patient samples of unmatched initial and recurrent timepoints profiled using the Illumina Infinium MethylationEPIC Array.

  Dataset EGAD00010002157

• LITS

  Difference in gene expression values between case and control, log2 values. Blood transcriptome from women participating in the Norwegian Women and Cancer study (NOWAC) Post-genome Cohort taken up to eight years before brest cancer diagnosis. Illumina HumanWG-6 version 3 or Illumina HumanHT-12 expression bead chip, combined on identical nucleotide universal identifiers.

  Dataset EGAD00010001400

• WGS

  Purified DNA from PDX samples were subjected to WGS. Libraries were performed using the TruSeq DNA PCR-Free kit (Illumina) starting with 1μg of input DNA and performed following manufacturer's instructions. Libraries were sequenced on a NovaSeq 6000 (2x151 bp) instrument (Illumina). A mean coverage of 30.4x was obtained.

  Dataset EGAD00001010309

• Paired Exome sequencing of Sarcoma tumor and control

  Paired Exome sequencing of Sarcoma tumor and control of 10 samples (5 tumor/control pairs). The sequencing was done on Illumina Hiseq 4000 and Agilent Sureselect V5+UTRs kit.

  Dataset EGAD00001010278

• sWGS data of Pap test smears and tumor tissues

  Shallow whole-genome sequencing data divided into three groups: - sWGS data from Pap smears of patients with confirmed high grade serous ovarian cancer - sWGS data from matched tumor tissue (at diagnosis) from the same patients - sWGS data from Pap tests smears of healthy women

  Dataset EGAD00001010141