19072 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 49.16 milliseconds.

• multi regional whole exome sequencing of gastric adenocarcinoma

  Multiregional whole-exome sequencing was done using 48 tumor samples (range: 4-10 tumor samples/patient) from 9 patients with adenocarcinomas of the stomach and gastroesophageal junction (GC)

  Dataset EGAD00001006251

• Targeted sequencing of HGS-EOC samples

  A 19-sample data set containing data from FFPE high grade serous ovarian cancer biopsies. The library was made with a custom hybridization kit (EZ-Cap, Roche) spanning 7 genes.

  Dataset EGAD00001006064

• 666PG genomic rearrangements

  Genomic rearrangement calls generated using Delly in VCF format from the CPCGene 666PG study

  Dataset EGAD00001006146

• Infant HGG targeted sequencing

  Targeted sequencing of infant high grade gliomas. BAM files of paired end reads aligned to GRCh37 with bwa. This targeted panel covers the exons of 435 genes commonly mutated in high grade gliomas in children.

  Dataset EGAD00001005248

• APCDR Uganda GWAS - High depth sequencing of a Baganda trio

  A family trio from Uganda (Baganda ethno-linguistic group) has been sequenced to high depth (ca. 30x) on the Illumina HiSeq 2500 platform.

  Dataset EGAD00001005346

• Targeted sequencing of patients with neurodegenerative diseases

  A targeted gene panel that covers coding, noncoding, and short tandem repeat regions improves the diagnosis of patients with neurodegenerative diseases

  Dataset EGAD00001005114

• Ovarian cancer sequencing dataset

  Sequencing data from patients with Ovarian cancer. Data utilised in the 'Enhanced detection of circulating tumor DNA by fragment size analysis' manuscript (Mouliere et al, 2018)

  Dataset EGAD00001004939

• Expanding the neurodevelopmental phenotypes of individuals with de novo KMT2A variants

  We have sequenced four samples to identify variants in KMT2A gene. Three samples were sequenced with WGS, one was sequenced by WES (Patient2).

  Dataset EGAD00001004838

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• H005 WES CLL

  Whole exome sequencing from matched tumor-control samples of 121 primary lymphoma samples. Sequencing was performed on Illumina HiSeq2000. The dataset contains FASTQ files.

  Dataset EGAD00001002055

• Breast RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001340

• BASIS RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001341

• BASIS WGBS

  Whole-genome bisulfite sequencing (WGBS) on 30 breast cancer cases from the BASIS project.

  Dataset EGAD00001001388

• RNAseq of LC2AD with AD80 or DMSO

  RNAseq of LC2AD with AD80 or DMSO Plenker et al., Mechanistic insight into RET kinase inhibitors targeting the DFG-out conformation in RET-rearranged cancer

  Dataset EGAD00001003316

• Mutations in GNAI2 Cause Developmental and Immune Dysregulation

  To define a genetic syndrome of dysmorphism, brain malformations, skeletal defects, endocrine and immune dysfunction, 11 patients from 11 unrelated families who had similar features were studied. Whole exome sequencing was performed to identify disease-causing mutations. A disease segregated with de-novo or autosomal dominant mutations in a single gene, GNAI2, encoding the Gαi2 protein. We define a new Congenital Disorder associated with Gαi2 mutations and downstream functional effects.

  Study phs002817

• Post-liver transplant recurrent human hepatocellular carcinoma study (RHCCS)

  The whole exome sequencing showed that HERC5 deletion and under-expression associates with shorter: time to tumor recurrence, progression-free, and overall survival in hepatocellular carcinoma (HCC) in two independent studies (p1=0.004, HR1=1.80; p2=0.018, HR2=3.31) totaling 286 HCC patients. Matched primary and recurrent tumors indicated a clonal selection advantage in somatic single nucleotide and copy number variants (CNVs) in recurrent compared to primary tumors of Chinese HCC patients with Wnt signaling most activated.

  Study phs000782

• Gene Fusion Discovery through RNA Sequencing of Human Glioblastoma Stem Cell Lines

  We used massively parallel, paired-end sequencing of expressed transcripts (RNA-seq) to detect novel gene fusions in short-term cultures of glioma stem-like cells freshly isolated from nine patients carrying primary glioblastoma multiforme (GBM). The culture of primary GBM tumors under serum-free conditions selects cells that retain phenotypes and genotypes closely mirroring primary tumor profiles as compared to serum-cultured glioma cell lines that have largely lost their developmental identities.

  Study phs000505

• Autosomal Recessive PGM3 Mutations Link Glycosylation Defects to Atopy, Immune Deficiency, Autoimmunity, and Neurocognitive Impairment

  To define a genetic syndrome of severe atopy, elevated serum IgE, immune deficiency, autoimmunity, and motor and neurocognitive impairment, eight patients from two families who had similar syndromic features were studied. Whole exome sequencing was performed to identify disease-causing mutations. A disease segregated with a novel autosomal recessive mutations in a single gene, phosphoglucomutase 3 (PGM3). The result defines a new Congenital Disorder of Glycosylation.

  Study phs000809

• Whole-Genome Sequencing Reveals Complex Genomic Features Underlying Anti-CD19 CAR T-Cell Treatment Failure in Lymphoma

  We performed Whole-Genome Sequencing (WGS) on 100 tumor and matched germline samples from 49 CD19-directed chimeric antigen receptor (CAR-19)-treated diffuse large B cell lymphoma (DLBCL) patients. We found that the presence of complex structural variants, APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide) mutational signatures, and genomic damage from reactive oxygen species predict CAR-19 resistance. BAM files will be available through dbGaP.

  Study phs003023

• DIGEST: Dietary Influences on Glucuronidation, a Cross-Sectional Study of Diet and Metabolism

  Plasma samples derived from a study population of control participants (DIGEST: Dietary Influences on Glucuronidation, a Cross-Sectional Study of Diet and Metabolism) were used to profile miRNA circulating in plasma. RNA was isolated from plasma samples using the Qiagen miRNeasy kit. Libraries were prepared using Illumina TruSeq Small RNA Library Prep Kit. Libraries were sequenced on a HiSeq. Data from this sequencing project will be available through dbGaP.

  Study phs003223

• Epigenetic Damage in Women Living in LA Food-Desert Zip Codes

  This study investigated the impact of insulin resistance on chromatin acetylation and inflammation. Blood samples were obtained from women consented to City of Hope Institutional Review Board (IRB)-approved COH Protocol#/Ref#:18306/158149. Women provided demographic information and completed a survey assessing diet, housing and medical history. BMI was obtained from medical records. HgbA1c was measured and cytokine arrays were used to measure serum TNFalpha, IL6, IL15, IL16, IL23, Leptin, and CXCL1.

  Study phs003522

• Genetics and Pathobiology of Disorders of Keratinization

  The goal of this study was to identify potential drivers of disorders of keratinization in human. Individuals diagnosed with disorders of keratinization were recruited with no exclusion criteria. Saliva or blood samples were taken from consented patients or family members and DNA harvested immediately. Whole exome sequencing was performed (150-bp paired end reads) to 80X coverage via an Illumina NovaSeq 6000 sequencer. Identification of germline mutations was performed using GATK.

  Study phs004172

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• Intercellular nanotube-mediated mitochondrial transfer enhances T-cell metabolic fitness and antitumor efficacy

  We found that bone marrow-derived mesenchymal stromal cells (MSC) establish nanotubular connections with T cells in a Talin 2 (TLN2)-dependent manner and leveraged these intercellular highways to supply new mitochondria to CD8+ T cells. In this experiment we analyzed the transcriptional profile of T cells co-cultured with MSC containing MSC derived Mitochondria (MitoPositive), T cells co-cultured with MSC not containing MSC derived Mitochondria and control T cells.

  Study EGAS00001007356

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  Immortalized control, patient-derived and CRISPR/Cas9-edited patient-derived myoblasts (known in the literature as C25, DM11, and DM11_1E6 cells, respectively) were grown confluent and were fused to myotubes in differentiation medium. Samples were collected at day -2 before initiation of differentiation (i.e. proliferation stage), at day 1 and at day 5 of differentiation in lysis buffer and stored at -70 degrees until all samples were collected.

  Study EGAS50000001152

• Landscape of somatic mutations and DNA copy number alterations and transcriptomic profiling identifies metabolic reprogramming as a hallmark of ibrutinib resistance

  Whole-exome sequencing (WES) was conducted on the clinical specimens of 14 cases that had sufficient isolated tumor DNA, including 7 ibrutinib-sensitive cases and 7 ibrutinib-resistant cases. Whole transcriptome sequencing (RNA-seq) was performed on clinical specimens isolated from 14 ibrutinib-sensitive and 7 ibrutinib-resistant cases. Unsupervised hierarchical clustering of MCL tumors using RNA-seq gene expression data showed a response-specific gene expression signature.

  Study EGAS00001003418

• scRNA-seq of CD4+ T cells from blood and tumor of NSCLC patients

  This study explore the CD4+ T cells diversity in paired blood and tumor of 5 different NSCLC patients. After FACS-sorted of Tregs (DAPI- CD45+ CD4+ CD25hi CD127lo) and Tconvs (DAPI- CD45+ CD4+CD25lo CD127lo/hi), cells were mixed in equal proportion (fifty/fifty ratio) and processed with 10X Chromium (10X Genomics) gene expression kit (3 bloods and 2 tumors) or immunoprofiling kit (2 bloods and 3 tumors) and sequenced using Illumina platforms.

  Study EGAS50000000293

• Functional analysis of GATA2 synonymous mutations

  Germline mutations in SAMD9 and SAMD9L (SAMD9/9L) genes predispose to myelodysplastic syndromes (MDS) and show high prevalence in pediatric MDS with monosomy 7. Here, we studied an international cohort of children with primary MDS to assess the prevalence, hematological features, genetics, clonal evolution and clinical outcome in patients with germline SAMD9/9L mutations compared to pediatric MDS with either germline GATA2 mutations or pediatric MDS with wildtype status in SAMD9/9L and GATA2 genes

  Study EGAS00001003817

• NEC

  This multi-centre, non-randomized, open-label, phase II trial (NCT03016338), assessed niraparib monotherapy (cohort 1, C1), or niraparib and dostarlimab (cohort 2, C2) in patients with recurrent serous or endometrioid endometrial carcinoma. The primary endpoint was clinical benefit rate (CBR). Secondary outcomes were safety and objective response rate (ORR). Translational research was an exploratory outcome. Potential biomarkers were evaluated in archival tissue by immunohistochemistry and next generation sequencing panel. Feasibility of liquid biopsy by ctDNA was assessed.

  Study EGAS00001007013

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Dataset EGAD00001000255

• FusionSeq: a modular framework for finding gene fusions by analyzing Paired-End RNA-Sequencing data

  We have developed FusionSeq to identify fusion transcripts from paired-end RNA-sequencing. FusionSeq includes filters to remove spurious candidate fusions with artifacts such as misalignments or random pairing of transcript fragments and it ranks candidates according to several statistics. It also has a module to identify exact sequences at breakpoint junctions. FusionSeq detected known and novel fusions in a specially sequenced calibration data set, including 8 cancers with and without known rearrangements.

  Study phs000311

• Spatial omics analysis of non-small cell lung cancers for revealing molecular statuses of intratumor heterogeneity and tumor microenvironment

  In this study, we perform spatial transcriptome analysis Visium/Xenium and other omics analysis using surgical specimens of Japanese non-small cell lung cancer cases to understand omics statuses of cancer cells and their surrounding stromal and immune cells in local tumor regions. We aim to stratify lung cancer patients with considering intratumor heterogeneity and complicated microenvironent of lung cancer tissues by using spatial omics data and histopathological information.

  Study JGAS000613

• EGAD00010000768

  Replication data for HipSci normal samples using both HumanCoreExome-12_v1 and HumanOmni2.5-8 BeadChips

  Dataset EGAD00010000768

• Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial)

  Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial). Panel sequencing data from baseline FFPE biopsies were used to perform a comprehensive genomic profiling of CUP metastases. Combined targeted next-generation sequencing of patient-specific hotsport mutations and shallow whole genome sequencing of baseline and follow-up liquid biopsy samples were used to analyze ctDNA and to evaluate response to immunei checkpoint inhibitor treatment. In some cases, whole exome sequencing of peripheral blood mononuclear cells was performed to screen for potential CHIP and germline mutations.

  Dataset EGAD00001011130

• Single cell RNA-seq and ATAC-seq of human fetal forebrain tissue, weeks 8 to 11.

  Single cell RNA-seq from 6 and single nuclei ATAC-seq from 3 human fetal tissue samples. Samples from 8 to 11 weeks. Includes a 8.5 weeks samples with matching both ATAC-seq and RNA-seq runs. Data was sequenced using 10X Genomics chromium technology, for scRNA-seq samples belong to v2 and v3.

  Dataset EGAD00001008653

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• FOCUS study

  Shallow whole genome sequencing of adavanced colorectal tumors from patients included in the FOCUS clinical trial. Performed to calculate assocations of irinotecan with copy-number alterations. Copy number aberration analysis of 349 enroled patients.

  Dataset EGAD50000001007

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RP3_Freeze_1

  Freeze 1 of the RP3 project

  Dataset EGAD00010000887

• The University of Hong Kong Intestinal Metaplasia Organoids Study scRNASeq Data

  Single cell encapsulation and cDNA libraries were prepared by Chromium™ Single Cell 5’ Reagent Kits and Chromium™ Single Cell A Chip Kit.

  Dataset EGAD00001015422

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• Germline WES data of children with pathogenic mutations in cancer predisposing genes

  This data set includes bam files (aligned to hg38) from the germline of children who have pathogenic mutations in cancer predisposing genes

  Dataset EGAD00001009854

• Germline WES data of parents whose children have germline CHEK2 mutations

  This data set includes bam files (aligned to hg38) from the germline of parents whose children have CHEK2 germline mutations.

  Dataset EGAD00001009516

• Gain of Function Mutations in RPA1

  Exome sequencing and amplicon-based single-cell sequencing dataset on the patients and family members that were analyzed in this study.

  Dataset EGAD00001008329

• postcovid19

  contain the raw data from scRNA, scATAC, genotyping.

  Dataset EGAD00001008122

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• WES data from optic atrophy study

  The dataset includes Fastq files from WES experiments performed on a proband presenting with syndromic optic atrophy and his healthy parents. Exons were captured by hybridization and sequenced on an Illumina platform

  Dataset EGAD00001005321

• cHCC-ICC WES

  The whole exome sequencing data of 291 tumor/normal samples from 121 cHCC-ICC cases.

  Dataset EGAD00001005183

• Whole exome sequencing of Finnish hereditary breast cancer families

  Dataset contains Whole Exome Sequencing(WES) data from 37 individuals as aligned bam-files. The reads have been aligned using bowtie2 to human genome hg19 build.

  Dataset EGAD00001002133

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• HIPO blastemal Wilms (nephroblastoma) CHIP sequencing samples

  HIPO blastemal Wilms (nephroblastoma) characterisation of tumor driving events caused by differential SIX1 binding of the SIX1 Q177R mutatns

  Dataset EGAD00001000992

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• EGAD00000000057

  WTCCC project samples from the Parkinson's disase cohort

  Dataset EGAD00000000057

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers

  WES and clonality characterization of different timepoints in HER2-negative primary breast cancers receiving neoadjuvant eribulin therapy.

  Study EGAS00001004953

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Long-read RNA-seq from 5 patients with stereotyped subset CLL

  Oxford Nanopore Technologies based long-read RNA sequencing data from 5 patients with stereotyped subset CLL. The BAM files were aligned against hg19 reference genome.

  Dataset EGAD50000000755

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Methylation profiling of sarcoma and TFCP2-rearranged rhadomyosarcoma samples

  Methylation profiling of 345 sarcoma and TFCP2-rearranged rhadomyosarcoma samples, using the approach described "Genomic, transcriptomic, functional, and mechanistic characterization of rhabdomyosarcoma with FUS-TFCP2 or EWSR1-TFCP2 fusions"

  Dataset EGAD00010002451

• The University of Hong Kong Gastric Cancer XClone Study Single Cell CNV Data

  Single cell encapsulation and DNA libraries were prepared by Chromium™ Single Cell DNA Reagent Kits and Chromium™ Single Cell C and D Chip Kits.

  Dataset EGAD00001015383

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cheek patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cheek patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004603

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cervix patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cervix patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004616

• Genome and transcriptome sequence data from a clear cell carcinoma of the left ovary patient

  Genome and transcriptome sequence data from a clear cell carcinoma of the left ovary patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004608

• Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient

  Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003716

• Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003723

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003725

• Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient

  Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003702

• Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient

  Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003691

• Genome and transcriptome sequence data from an adenocarcinoma of the distal esophagus patient

  Genome and transcriptome sequence data from an adenocarcinoma of the distal esophagus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003061

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003065

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003073