19229 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 54.14 milliseconds.

• Sutherland Nine Raw Sequencing Data

  These Fastq-files contain the raw sequencing output from our two sequencing experiments (Shotgun and Capture). All libraries with "*SG*" refer to Shotgun genomes, while all files containing "*TF*" refer to 1240K capture data.

  Dataset EGAD50000001417

• Targeted sequencing of intestinal metaplasia

  We perform targeted DNA sequencing of intestinal metaplasia of 463 IM and paired germline samples. An additional 48 IM and paired germline samples were included as validation cohort. The dataset contains cram files from 1022 IM and paired normal samples.

  Dataset EGAD50000001540

• Active-Seq of CRC patients

  This dataset contains 48 fastq files of samples derived from CRC patients, including colorectal cancer tissue, normal adjacent tissue and cfDNA samples, processed with the Illumina platform NovaSeq6000.

  Dataset EGAD50000001746

• Paired-end RNA-seq FASTQ files from amniotic fluid samples

  Paired-end RNA-seq FASTQ files from amniotic fluid samples of 49 extreme premature births, affected and unaffected by the fetal inflammatory response.

  Dataset EGAD50000001260

• Transcriptome - Uveal Melanomas MPI

  Total RNA sequencing on 4 uveal melanoma samples. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001138

• T Cell Signatures (Cityscape)

  T cell signatures from tumor RNAseq in CITYSCAPE with overall survival data. T cell signatures can be associated with the other clinical CITYSCAPE data .

  Dataset EGAD50000000932

• The Dynamic Immune Behavior of Primary and Metastatic Ovarian Carcinoma

  Single-cell RNA-seq data of prospectively collected normal ovarian tissue sample from 1 healthy individual and tumor tissue samples with or without chemotherapy from 19 HGSOC patients.

  Dataset EGAD50000000057

• Single-cell somatic copy number variants in brain using different amplification methods and reference genomes

  This dataset contains 224 paired fastq files (112 single cells) from the following samples: brains from two Multiple System Atrophy patients and one control, and non-brain controls (fibroblasts, NA12878)

  Dataset EGAD50000000030

• Methylation Array of pre- and post-5ZA-treated head and neck cancer patients refractory to anto-PD-1 therapy

  Illumina MethylationEpic Beachip data generated from tissue samples collected from head and neck cancer patients refractory to anti-PD-1 therapy, collected before and after the 5AZA treatment

  Dataset EGAD00010002718

• Pan Prostate Cancer Group Germany BAM files

  German early-onset prostate cancer whole-genome sequencing samples of the Pan-Prostate Cancer Genome (PPCG) project. Whole Genome Sequencing Illumina data from men with prostate cancer. Samples were taken from primary tissue obtained at prostatectomy with matched blood control.

  Dataset EGAD00001005997

• Signatures of mismatch repair deficiency in cancer genomes

  DNA replication errors occurring in mismatch repair (MMR) deficient cells persist as mismatch mutations and predispose to a range of tumors. Here, we sequenced the first whole-genomes from MMR-deficient endometrial tumors.

  Dataset EGAD00001000641

• Plasma cell-free H3K4me3 chromatin immunoprecipitation sequencing

  This dataset contains plasma cell-free nucleosome H3K4me3 chromatin immunoprecipitation sequencing (cfChIP-seq) from metastatic breast cancer patients and healthy individuals. Sequencing was performed on Illumina platforms and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002525

• DNA polymerase and mismatch repair exert distinct microsatellite instability signatures in normal and malignant human cells

  Whole genome sequencing data used in the manuscript: DNA polymerase and mismatch repair exert distinct microsatellite instability signatures in normal and malignant human cells.

  Dataset EGAD00001006593

• 5hmC enrichment in human monocyte differentiation

  This dataset consists of 5hmC capture-seq data from human monocytes, monocyte-derived dendritic cells. It includes two biological replicates and three time points. Including controls, the dataset comprises 10 samples in total.

  Dataset EGAD00001006603

• RNA-seq assessment of the impact of fasting-mimicking diet on tumor tissue specimens from early-stage breast cancer patients

  RNA-seq data (44 samples) from tumor tissue specimens pre and post fasting-mimicking diet from 22 early-stage breast cancer patients.

  Dataset EGAD00001006860

• Smart-seq2 raw reads of human kidney glomerular single cells

  Smart-seq2 single cell RNA sequencing reads from kidney glomerular single cells of healthy human individuals. The dataset contains single-end fastq files of 766 single cells.

  Dataset EGAD00001006861

• ATAC-seq

  ATAC-seq data. Dataset includes FASTQ files, BAM files, and analysis files with the ATAC-seq peaks determined using MACS2.

  Dataset EGAD00001008962

• Genomic data of acute myeloid leukemia from the NGS-PTL european consortium

  Whole exome sequencing (WES) data of paired (germline and leukemic) samples of 60 adult patients affected by acute myeloid leukemia.

  Dataset EGAD00001007940

• 6_RNAseq_NOVA1_KO_vs_wt

  iPSC-derived motor neurons from 5 NOVA1 knock out and 5 NOVA1 wt lines in the CVB background.

  Dataset EGAD00001008427

• Mutation analysis AVENIO of NSCLC patients

  Mutation analysis of 77 frequently mutated genes in NSCLC in plasma DNA and corresponding PBMCs of NSCLC patients under ICI using the AVENIO Expanded Kit.

  Dataset EGAD00001007930

• Characterization of Arabian Peninsula whole exomes

  We conducted whole exome sequencing (using the SureSelect Human All Exon V5 + UTRs target enrichment kit) of 90 individuals from AP (23 from Saudi Arabia, 24 from Yemen, 24 from Oman and 19 from UAE).

  Dataset EGAD00001009162

• 9 samples variant calling data

  This dataset comprise results of mutect2 variant calling in vcf format on 9 samples of rosette forming brain tumors (5 with paired normal tissue and 4 without). Only variants specific to the tumor where kept to comply with patients consent.

  Dataset EGAD00001009266

• WXS of IgAN-tGBM, IgAN and TBMN

  The dataset consists of 258 bam files by whole exome sequencing. 122 from IgAN-tGBM patients, 64 from IgAN patients and 72 fromTBMN patients.

  Dataset EGAD00001009287

• Exome and transcriptome sequencing of CDS and ES tumor samples

  This dataset contains WES and RNASeq data of 31 CDS and ES tumor and control samples. Sequencing was performed on Illumina NovaSeq 6000. The sequencing was performed paired in bulk.

  Dataset EGAD00001015608

• Extensive and differential platinum chemotherapy mutagenesis in livers of children - RNA

  Bulk RNA sequencing of normal liver and liver tumours from children. Five of the children had liver cancer and samples was taken at surgery. Two children had non-liver type of cancer and liver samples were obtained postmortem.

  Dataset EGAD00001016117

• In vitro mutational load

  Clonally expanded human pluripotent and adult (liver + intestine) stem cell clones were subjected to whole genome sequencing to determine the mutational impact of in vitro culture

  Dataset EGAD00001004104

• WGS of HSPCs and MSCs

  Whole genome sequencing data of organoid cultures derived from human bone marrow-derived and cord blood-derived hematopoietic stem and multipotent progenitor cells to study the mutation accumulation.

  Dataset EGAD00001004451

• SLC9A3R1 variant associated with age-related hearing loss

  The dataset contains one BAM file that includes a SLC9A3R1 variant identified in two Italian patients affected by age-related hearing loss. Data have been produced by targeted re-sequencing, using Ion Torrent PGM platform.

  Dataset EGAD00001004171

• Use of deep sequencing to detect clonal mutations in sun exposed human epidermis - whole genome

  Deep sequencing of two skin biopsies to study the landscape of somatic mutations in human adult tissues.

  Dataset EGAD00001001123

• Hepatocellular adenomas samples

  Whole exome sequencing data from 30 donors (46 tumors and 30 non-tumoral whole exome sequencing, paired-end, HiSeq 2000, Illumina) collected by the Inserm U674, PI Jessica Zucman-Rossi - Institut National du Cancer (INCa), PI Fabien Calvo, France.

  Dataset EGAD00001000737

• MGRB dataset. GATK joint called variants of 2570 phase 2 samples.

  This dataset comprises a 2572 sample joint called vcf from the Medical Genome Reference Bank.

  Dataset EGAD00001005228

• PCa mtDNA data

  50 paired benign/cancer samples from prostate tissue generated in 2 different runs - on 3 plates on the IonTorrent Proton. Total of 200 fastq.gz single end runs. Read length ~300 bp. %GC 44 Sequences per file approx 1 Mio.

  Dataset EGAD00001005945

• Whole genome sequence of intratumor heterogeneity study

  This dataset contains whole genome sequence data from 12 samples from 1 patient, including 8 tumor sectors and 4 normal samples. All the experiments were performed on Illumina HiSeq platform with raw reads stored in fastq format.

  Dataset EGAD00001005452

• Epigenetic subtypes of neuroblastoma - ChIPseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide genome wide H3K27ac profiles in 60 primary neuroblastoma samples.

  Dataset EGAD00001006285

• Single Cell Sperm from fathers of Autistic Children

  Single cell sequencing of fathers who have had children with autism and fathers who have had multiple children, but no children with autism. The data was process on a 10X Chromium and sequenced on a NextSeq

  Dataset EGAD00001006292

• Matched FF and FFPE WGS from a metastatic prostate tumor

  This dataset contains three bam files. One normal blood sample and two matched FF and FFPE samples from the same metastatic prostate tumor.

  Dataset EGAD00001006180

• EPC (eccrine porocarcinoma) WES samples

  Whole-exome sequencing (WES) in a well-characterized sample of 14 matched EP tumour/healthy surrounding tissue samples. The sequencing was done with paired EXOME sequencing on Illumina HiSeq 4000 using Agilent SureSelect XT HS + Human All Exon V7.

  Dataset EGAD00001006395

• Cam_121 RNA-Seq data

  This dataset contains RNA-Seq data from 204 primary melanomas and 177 regional lymph nodes. More details can be found in the manuscript: "Tumour gene expression signature in primary melanoma predicts long-term outcomes: A prospective multicentre study"

  Dataset EGAD00001006401

• To determine the genomic profiles of Triple Negative Breast Cancers (COH cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (COH_TNBC_WGS)

  Study EGAS00001006085

• To determine the genomic profiles of Ovarian carcinomas (UW cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (UW_OvCa_WGS)

  Study EGAS00001006048

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Mutational Landscape of Lethal Castrate Resistant Prostate Cancer

  Exome sequencing of matched pairs of tumor / normal genomic DNA was performed from high risk localized prostate cancer or lethal, metastatic, castrate resistant prostate cancer (CRPC). Exome libraries were prepared using Illumina Paired_End Genome DNA Sample Prep Kit and captured using Agilent SureSelect Capture Library or Roche EZ Exome capture library. Sequencing was performed on Illumina GAII and HiSeq 2000 platforms in paired end mde, with 80 base pair reads from the final library fragments. Copy number alterations and somatic mutations were identified.

  Study phs000554

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• Transcriptomic Profiling of an Anti-PD-L1 Treated Cohort of Newly Diagnosed GBM Patients

  Checkpoint inhibitor therapy has limited efficacy in glioblastoma patient outcomes. This study involves RNA sequencing (RNA-seq) of newly diagnosed GBM patients treated with concurrent atezolizumab, radiation therapy, and temozolomide. By analyzing RNA-seq data from 39 tumors, the study aims to explore tumor transcriptomic features, including immune-based transcriptomic programs and immune infiltration, to understand their influence on PD-L1 blockade treatment efficacy and to identify which patients may benefit more from such therapy.

  Study EGAS50000000784

• scRNA-seq of CD4+ T cells from blood, lymph nodes and tumors of NSCLC patients

  This study explore the CD4+ T cells diversity in paired blood, lymph nodes and tumors of 5 different NSCLC patients. After FACS-sorted of Tregs (DAPI- CD45+ CD4+ CD25hi CD127lo) and Tconvs (DAPI- CD45+ CD4+CD25lo CD127lo/hi), cells were mixed in equal proportion (fifty/fifty ratio) and processed with 10X Chromium (10X Genomics) gene expression kit (3 bloods, 2 lymph nodes and 2 tumors) or immunoprofiling kit (2 bloods, 4 lymph nodes and 3 tumors) and sequenced using Illumina platforms.

  Study EGAS50000000293

• Location specific ACVR1, FGFR1 and TP53 mutations in pediatric glioblastomas in conjunction with H3.3 K27M.

  Recurrent somatic H3 K27M mutations characterize midline pediatric high-grade astrocytomas (pHGAs). In 40 treatment-naïve midline pHGAs we find additional somatic mutations specific to tumor location. Gain-of-function mutations in ACVR1 occur in tumors of the pons in conjunction with H3.1K27M, while FGFR1 mutations/fusions occur in thalamic tumors in conjunction with H3.3 K27M. Genetic profiles of pHGA show actionable targets, suggesting that pre-treatment biopsy could effectively orient therapeutic efforts.

  Study EGAS00001000720

• Bulk RNAseq gene expression of baseline tumors from metastatic urothelial bladder cancer patients (IMvigor210) and metastatic renal cell carcinoma (IMmotion150)

  We examined tumors from a large cohort of patients with metastatic urothelial bladder cancer (mUC) and metastatic renal cell carcinoma (mRCC) treated with an anti-PD-L1 agent (atezolizumab) and found that high tumor IL8 gene expression was associated with worse overall survival (OS). We further identified the tumoral immune presence based on Teff signature. We found that high tumor IL8 expression continued to be associated with worse OS even in inflamed tumors in mUC and mRCC.

  Study EGAS00001004386

• Evolutionary Genome Analysis of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas

  Anecdotal case have been reported lung adenocarcinoma could occasionally transform into small cell carcinoma. Most of the reported cases were EGFR-mutant lung adenocarcinomas that transform into small cell carcinoma during EGFR tyrosine kinase inhibitor treatment. However, some cases also indicate lung adenocarcinomas without EGFR mutation could also transform into small cell carcinomas. Here we investigate this transformation process by whole genome sequencing of transformed small cell carcinomas as well as serially acquired samples of lung adenocarcinoma into small cell carcinomas.

  Study EGAS00001001757

• Whole Exome DNA Sequencing of matched brain tumor-normal pairs

  Illumina HiSeq sequence data (with >80x coverage) were aligned to the hg19 human reference genome assembly using BWA (Li and Durbin, 2009); duplicate reads were removed from the final BAM file. No realignment or recalibration was performed.The whole exome sequencing data of 20 SHH medulloblastomas from phs000504.v1.p1 dataset has been used in our study on SHH medulloblastomas: http://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/study.cgi?study_id=phs000504.v1.p1

  Dataset EGAD00001000698

• Whole Genome DNA Sequencing of matched brain tumor-normal pairs (ICGC)

  Illumina HiSeq sequence data (with >30x coverage) were aligned to the hg19 human reference genome assembly using BWA (Li and Durbin, 2009); duplicate reads were removed from the final BAM file. No realignment or recalibration was performed.

  Dataset EGAD00001000697

• UMCU_Molpheno_Restricted

  This dataset contains Whole Genome Sequencing and, if available, RNA-sequencing and/or ATAC-sequencing data obtained from PBMCs derived from blood samples of 34 patients with intellectual disability and/or multiple congenital anomalies and their biological parents (58) included in the University Medical Center Utrecht (The Netherlands).

  Dataset EGAD00001004865

• Mutational Landscape of Plasmablastic Lymphoma

  Plasmablastic lymphoma (PBL) represents a clinically heterogeneous subtype of aggressive B-cell non-Hodgkin lymphoma. Although targeted sequencing studies and a single center whole exome sequencing (WES) study in HIV+ patients recently revealed several genes, associated with PBL pathogenesis, the global mutational landscape and transcriptional profile of PBL remain elusive. To inform on disease-associated mutational drivers, mutational patterns and perturbed pathways in HIV+ and HIV- PBL we performed WES and RNA-sequencing (RNA-seq) of 34 PBL tumors.

  Study EGAS00001004906

• Relapse series of two Pediatric ALL patients

  In this proof of principle study, we performed whole genome sequencing of two cases with multiple relapses in order to investigate whether groups of mutations separated in time show distinct mutational signatures. In patient 1, who experienced two relapses, the analysis unraveled a continuous interplay of aberrant AID/APOBEC-associated activities. Patient 2 had three relapses. We identified episodic mutational processes at diagnosis and first relapse leading to mutations resembling UV light-driven DNA damage, and thiopurine-associated damage at first relapse.

  Study EGAS00001005001

• PELICAN33 longitudinal clinical and autopsy phenomic assessment in lethal metastatic prostate cancer

  Objective: To identify novel phenotypes and features associated with metastatic prostate cancer (mPC) outcome, and to identify biomarker and data requirements to be tested in future precision oncology trials. Design, Setting, and Participants: We analyzed deep longitudinal clinical, neuroendocrine expression, and autopsy data of 33 men who died from mPC between 1995 and 2004 (PELICAN33), and related findings to mPC biomarkers reported in the literature. Intervention: 33 men prospectively consented to participate in an integrated clinical-molecular rapid autopsy study of mPC.

  Study EGAS00001005399

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the salivary gland patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the salivary gland patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010992

• Genome and transcriptome sequence data from a metastatic lymphoepithelial carcinoma of the parotid gland patient

  Genome and transcriptome sequence data from a metastatic lymphoepithelial carcinoma of the parotid gland patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010993

• Genome and transcriptome sequence data from a paget disease of the vulva patient

  Genome and transcriptome sequence data from a paget disease of the vulva patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001011003

• Genome and transcriptome sequence data from a poorly differentiated adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a poorly differentiated adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001011006

• Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient

  Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003017

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003005

• Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003011

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003012

• Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003016

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003657

• Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003669

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003673

• Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient

  Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003691

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the esophagus patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the esophagus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004668

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004684

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004680

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004673

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004640

• Genome and transcriptome sequence data from a high grade sarcoma of the epithelioid/spindle cell patient

  Genome and transcriptome sequence data from a high grade sarcoma of the epithelioid/spindle cell patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004648

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004652

• Genome and transcriptome sequence data from a metastatic primitive neuro-ectodermal tumor of the testicle patient

  Genome and transcriptome sequence data from a metastatic primitive neuro-ectodermal tumor of the testicle patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004660

• Genome and transcriptome sequence data from a metastatic clear cell carcinoma of the ovary patient

  Genome and transcriptome sequence data from a metastatic clear cell carcinoma of the ovary patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004661

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004663

• Whole Genome sequencing of individuals from Carlantino, Italy

  This study includes whole-genome sequencing data (at 4x depth) of 100 individuals from an Italian genetic isolate population (Carlantino, abbreviated CARL) of the Italian Network of Genetic Isolates (INGI). The INGI-CARL_SEQ project aims to combine available extensive genetic and phenotypic data to the latest high-throughput genome sequencing technology and ad hoc statistical analysis to identify new rare genetic variants underlying complex traits.

  Dataset EGAD00001000774

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002595

• Genome and transcriptome sequence data from an adenoid cystic carcinoma of the trachea patient

  Genome and transcriptome sequence data from an adenoid cystic carcinoma of the trachea patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002627

• Genome and transcriptome sequence data from a small cell/neuroendocrine carcinoma of the lung patient

  Genome and transcriptome sequence data from a small cell/neuroendocrine carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002617

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• scRNA-seq and scTCR-seq from 7 MF patients

  Dataset containing scRNA and scTCR sequencing of 7 patients with cutaneous T cell lymphoma. Sequencing was performed on Illumina NextSeq 550, HiSeq 4000 and NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD50000000332

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274