15070 results for "cancer studies using rna-seq"

in 19.86 milliseconds.

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Genomic alterations in MM - CEL

  RNA from the same tumor sample (n=98) was also processed using the 3' IVT kit (Affymetrix) and hybridized to U133 Plus 2.0 arrays (Affymetrix).

  Dataset EGAD00010001577

• Single-cell RNA-sequencing of H3-K27M diffuse midline glioma.

  Fastq files are deposited for single-cell transcriptomes of patient H3-K27M diffuse midline gliomas, generated using the SMART-seq2 method.

  Dataset EGAD00001011339

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Title: Divergent levels of CD112 and INKA1 define a distinct subset of human long-term hematopoietic stem cells

  The data provided here was critical in establishing that human long-term hematopoietic stem cells (LT-HSC), previously described as the most primitive HSC population, is actually composed of distinct subsets that can be prospectively isolated. Via mechanistic studies centering around the Rho-GTPase effector kinase PAK4 and its inhibitor INKA1, we identified the immune checkpoint ligand CD112 as a marker for hematopoietic stem and progenitor cells, that is highest expressed on LT-HSC. More importantly, CD112 can be used to stratify functionally distinct subsets within LT-HSC: In response to regeneration-mediated stress, the CD112low subset exhibits a transient restraint (termed latency) before contributing to hematopoietic reconstitution, while the CD112high subset is primed to respond rapidly. High resolution RNA-seq of the CD112 surface expression spectrum within rare LT-HSC subsets (human umbilical cord blood) demonstrated that more genes are differentially upregulated in the deeper quiescent and less metabolic active subset. Genes enriched in this subset centre around cell adhesion and Rho-GTPase signaling. This is in agreement with the scRNAseq data from human G-CSF mobilized peripheral blood (mPB) generated here that was used as an model of in vivo activation/priming revealing via RNA-velocity and pseudo-time analysis that INKA1high versus PAK4high, CDK6high and CD112high enrichment are either detected early or late in diffusion pseudotime indicative of quiescent versus primed cell status, respectively. RNAseq following INKA1 overexpression in LT-HSC and ST-HSC revealed by GSEA an overall stemness preserving phenotype and particularly in LT-HSC, but not in short-term HSC (ST-HSC), suppression of transcriptional programs linked to activation. Collectively, our data decipher the molecular intricacies underlying HSC heterogeneity and self-renewal regulation and point to latency as an orchestrated physiological response that integrates quiescence control with HSC fate choices to preserve a stem cell reservoir.

  Dataset EGAD00001006541

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• A microRNA-signature that correlates with cognition and is a target against cognitive decline

  While some individuals age without pathological memory impairments, others develop age-associated cognitive diseases. Since changes in cognitive function develop slowly over time in these patients, they are often diagnosed at an advanced stage of molecular pathology, a time point when causative treatments fail. Thus, there is great need for the identification of inexpensive and minimal invasive approaches that could be used for screening with the aim to to identify individuals at risk for cognitive decline that can then undergo further diagnostics and eventually stratified therapies. In this study we use an integrative approach combining the analysis of human data and mechanistic studies in model systems to identify a circulating 3-microRNA signature that reflect key processes linked to neural homeostasis and informs about cognitive status. We furthermore provide evidence that expression changes of this signature represent multiple mechanisms de-regulated in the aging and diseased brain and are a suitable target for RNA therapeutics.

  Study EGAS00001005627

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794