21043 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 28.79 milliseconds.

• WTCCC case-control study for Breast cancer - Combined Controls

  WTCCC genome-wide case-control association study for Breast cancer (BC) - Combined Controls.

  Study EGAS00000000025

• cfDNA dataset with expanded panel for cfDNA cohort

  Cell free DNA sequencing data for 9 samples with expanded panel across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000667

• PPGL RNA-Seq dataset 2

  Dataset includes fastq files for RNA-Seq experiments for tumor samples of PPGL patients. Single end reads fastq files are available for 81 different samples

  Dataset EGAD50000000019

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• cfDNA dataset with whole genome sequencing for cfDNA cohort

  Cell free DNA sequencing data for 13samples with whole genome sequencing across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000666

• RNASeq files for Klco PanAML data

  RNASeq files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011294

• WGS files for Klco PanAML data

  WGS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011295

• WXS files for Klco PanAML data

  WXS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011296

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Dataset EGAD00001012638

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• WTCCC case-control study for Ankylosing Spondylitis - Combined Controls

  WTCCC genome-wide case-control association study for Ankylosing Spondylitis (AS) - Combined Controls.

  Study EGAS00000000019