17558 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 22.72 milliseconds.

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• WGS of a hepatoblastoma patient with atypical tetrasomy 18

  WGS was performed on 4 samples from a hepatoblastoma patient with atypical tetrasomy 18. 2 hepatoblastoma samples (1 diagnostic biospy and 1 resected tumor), 1 blood sample and 1 non-tumor liver sample were sequenced.

  Dataset EGAD00001015507

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• DAC for DKFZ Recording physiological history of cells with chemical labeling

  DAC for the data in the publication "Recording physiological history of cells with chemical labeling" from DKFZ for Tobias Kessler (t.kessler@dkfz-heidelberg.de), Frank Winkler (frank.winkler@med.uni-heidelberg.de) and Kai Johnsson (johnsson@mr.mpg.de)

  Dac EGAC50000000054

• Patient-Parent trio sequencing for 100 sporadic ID patients

  Single end short-read (50 bp) SOLiD 4 sequencing data for 300 individuals, constituting 100 patient-parent trios. For more details please read; http://www.nejm.org/doi/full/10.1056/NEJMoa1206524

  Dataset EGAD00001000680

• Mantle cell lymphoma exomes and genomes for finding driver mutations

  Tumor and normal exomes for 51 MCL patients and tumor and normal genomes for 34 MCL patients.

  Dataset EGAD00001006159

• Exome sequencing data for LMS tumor and control samples

  The data set contains paired end fastq files for whole exome sequencing data for Leiomyosarcoma tumor and control samples

  Dataset EGAD00001003829

• DAC for Melanoma Exome Dataset for Identification of Mutated Epitopes

  Dac EGAC00001000546

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002208

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• EHMT2 alterations cause a Kleefstra-like syndrome

  We report clinical and molecular correlates associated with six de novo EHMT2 variants identified in patients presenting with a Kleefstra syndrome–like phenotype. Transcriptomic profiling of patient-derived fibroblasts and induced pluripotent stem cells (iPSCs) reveals shared gene expression signatures between EHMT2 variant carriers and Kleefstra syndrome, compared with cell lines derived from healthy donors.

  Study EGAS50000001637

• Three large nuclear families in which a single child per family was diagnosed with cancer

  We collected saliva samples from three nuclear families having 4, 5, and 7 children, respectively. One child in each nfamily had been diagnosed with a pediatric tumor, and neither parent had been diagnosed with cancer. Diagnoses included Wilms tumor, low-grade astrocytoma, and Burkitt’s lymphoma, respectively. We used whole-genome sequencing to profile normal cells from each family member and a linked-read technology.

  Dataset EGAD00001007709

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303