10963 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 14.00 milliseconds.

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Research Program on Genes, Environment and Health (RPGEH)

  The Kaiser Permanente Research Program on Genes, Environment, and Health (RPGEH) is a resource developed to facilitate research on genetic and environmental factors on common diseases and healthy aging. The RPGEH resource links biospecimens, health surveys, and comprehensive electronic medical records on broadly consented adult members of Kaiser Permanente Medical Care Plan, Northern California Region (KPNC). KPNC is an integrated health care delivery system with a membership of approximately 3.3 million people in northern California. The membership of KPNC is representative of the general population in the 14 county area in which facilities are located, although extremes of income are underrepresented. At the end of 2013, the RPGEH resource included: (1) demographic and behavioral surveys from over 430,000 participants; (2) biospecimens (DNA, serum, plasma, and/or saliva) from over 204,000 participants, including over 13,000 pregnant women; (3) genome-wide genotype data (70 billion SNP genotypes) on over 100,000 participants, including the Genetic Epidemiology Research on Adult Health and Aging (GERA) cohort; and (4) the longitudinal electronic medical records of the participants. The RPGEH was developed beginning in 2005 at the Division of Research of Kaiser Permanente Northern California by Catherine Schaefer (Director), Neil Risch (Co-Director), Lisa Croen, Eric Jorgenson, Lawrence Kushi, Charles Quesenberry, Sarah Rowell, Carol Somkin, Stephen Van den Eeden, Larry Walter, and Rachel Whitmer. Funding of the RPGEH was provided to C. Schaefer (PI) and N. Risch (co-PI) by the Wayne and Gladys Valley Foundation, The Ellison Medical Foundation, the Robert Wood Johnson Foundation, Kaiser Permanente Northern California, and the Kaiser Permanente National and Regional Community Benefit Programs. The GERA cohort was funded by a grant from NIH to RPGEH and UCSF (RC2 AG036607; C. Schaefer and N. Risch, PIs). At the time of the award of the RC2 project in late 2009, the RPGEH had established a cohort of about 140,000 individuals who had answered a detailed survey, provided saliva samples for extraction of DNA, and given broad consent for the use of their data in studies of health and disease. Survey and Cohort Recruitment. Initially, the RPGEH developed electronic disease registries to enable identification of phenotypes, using algorithms applied to EMR data. In 2007, the RPGEH mailed a four page survey to 1.9 million adult (≥ 18 years old) members of KPNC who had been members for two years or more, to obtain data on demographic and behavioral factors complementary to the clinical data in the EMR. The survey materials included a cover letter introducing the RPGEH, a two page list of Frequently Asked Questions, and the survey, which included questions on demographic factors such as education, race-ethnicity, income and marital status, dietary factors, physical activity, smoking, and alcohol consumption, as well as reproductive history and reproductive health. Members whose electronic medical records indicated a preference for written communications in Chinese or Spanish received survey materials both in English and a Chinese or Spanish translation. Approximately 400,000 completed surveys were returned. Saliva Sample Collection. Beginning in July 2008, respondents to the survey were asked to sign and return a consent form and authorization for use and disclosure of protected health information. The consent form authorized broad use of biospecimens, survey data, and data from participants' electronic health records for use in studies of genetic and environmental influences on health and disease. Respondents who returned completed consent forms were mailed (Oragene) saliva collection kits; more than 132,000 saliva samples were collected in two years. Completed saliva kits were scanned and archived in a temporary biorepository at the KPNC Division of Research. In late 2009, the RPGEH began collection of saliva samples from the California Men's Health Study (CMHS), a cohort that had been previously assembled in 2002-2003 and had been excluded from the RPGEH survey mailing with the intent of later adding CMHS participants to the assembled RPGEH cohort. The CMHS was developed to facilitate research on prostate cancer and other conditions in older men; the study protocol is described in Enger, et al., 2006. It enrolled and surveyed more than 40,000 men in KPNC, ages 45-69 years, who were members of KPNC during 2002-2003. CMHS men completed two mailed surveys with demographic and behavioral data similar to that of the RPGEH. The data on analogous variables were reconciled and integrated with the data derived from the RPGEH cohort for use in the RPGEH resource. By 2011, RPGEH collected approximately 15,400 saliva samples from men participating in the CMHS. RPGEH Access and Collaborations Website and Procedures. The RPGEH maintains a web portal for inquiries and applications for collaboration and access to data. The url is: https://rpgehportal.kaiser.org/. RPGEH has an application process and an Access Review Committee that reviews applications for collaboration and use. For more information, please contact RPGEH through the website.

  Study phs000788