12299 results for "fc coins kopen ps4 Besuche die Website Buyfc26coins.com. Coins in Minuten da..Gidj"

in 20.35 milliseconds.

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Multi-omics characterisation of immune cells in Long Covid

  We generated 10X Multiomics (paired RNA+ATAC) for Long Covid patients with up to 14 months follow-up.

  Study EGAS50000000142

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• Triple-negative breast cancer sequencing data

  Single-cell RNA sequencing and spatial transcriptomic sequencing data associated with manuscript 'Ectopic NMDAR expression in cancer unmasks germline-encoded autoimmunity'

  Dataset EGAD50000002266

• Analysis of the lung gene expression profile in COPD

  Samples obtained from patients with COPD and from controls by bronchoscopy from the lung were subjected to RNA seq.

  Study EGAS00001001472

• Therapeutic vulnerabilities in the DNA damage response for the treatment of ATRX mutant neuroblastoma

  Whole genome sequencing of ATRX / TP53 knockdown clones of the neuroblastoma cell line SK-N-SH

  Study EGAS00001004550

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• Dataset for synovial_sarcoma-WHOLE_GENOME

  Rare cancer sequencing data of 6 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008899