17507 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 38.50 milliseconds.

• National Eye Institute Glaucoma Human Genetics Collaboration (NEIGHBOR) Consortium Glaucoma Genome-Wide Association Study

  This is a case-control study of primary open angle glaucoma (POAG). POAG is an intraocular pressure (IOP) related progressive optic neuropathy that ultimately leads to blindness. For this study we have formed a collaborative consortium contributing 2170 POAG cases and 2347 controls with a unified definition of POAG (the NEIGHBOR consortium: NEI Glaucoma Human genetic collaBORation). The case definition has also been harmonized with an additional 976 cases and 1140 controls from the NHGRI supported GENEVA (gene-environment) study of glaucoma (GLAUGEN) (NIH/NHGRI U01HG004728, Pasquale PI). Cases and controls were recruited from ophthalmology clinics and were examined by ophthalmologists. For cases, the clinical exam included intraocular pressure measurements, optic nerve assessment and visual field evaluation. Controls had no family history of glaucoma, normal intraocular pressure and normal optic nerves. Cases and controls were also drawn from two clinical trial populations: Advanced Glaucoma Intervention Study (AGIS, NEI U10EY006827, D. Gaasterland PI) and Collaborative Initial Glaucoma Treatment Study (CIGTS, NEI U10 EY009149, P. Lichter PI). The NEIGHBOR consortium has two Co-Principal Investigators: J. Wiggs (Harvard, MEEI), and M. Hauser (Duke). The consortium includes eleven different centers where data collection and analysis take place. The eleven sites and investigators are: Harvard Medical School (Massachusetts Eye and Ear Infirmary) (J. Wiggs, L. Pasquale); Duke University Medical Center (M. Hauser, E. Hauser, R. Allingham, S. Schmidt); University of Michigan (J. Richards, S. Moroi, P. Lichter); University of Miami (M. Pericak-Vance, R. Lee, D. Budenz); Vanderbilt University (J. Haines); University of California San Diego (K. Zhang, R. Weinreb; T. Gaasterland); University of Pittsburgh (J. Schuman, G. Wollstein); University of West Virginia (A. Realini, J. Charlton, S. Zareparsi); Johns Hopkins University (D. Friedman, D. Zack); Stanford University (D. Vollrath, K. Singh), Eye Doctors of Washington (D. Gaasterland). Hemin Chin serves as the NEI Staff Collaborator. This national collaborative study is supported by multiple NIH grants: NEI R01 EY015543 (Allingham); NEI U10 EY006827 (D. Gaasterland); NHLBI R01 HL073389 (E. Hauser); NEI R01 EY13315 (M. Hauser); NEI U10 EY009149 (Lichter); NEI R01 EY015473 (Pasquale); NEI U10 EY012118 (Pericak-Vance); NEI R03 EY015682 (Realini); NEI R01 EY011671 (Richards); NEI R01 EY09580 (Richards); NEI R01 EY013178 (Schuman); NEI R01 EY015872 (Wiggs); NEI R01 EY009847 (Wiggs); NEI R01 EY010886 (Wiggs); NEI R01 EY144428 (Zhang); NEI R01 EY144448 (Zhang); NEI R01 EY18660 (Zhang). Funding support for genotyping, which was performed at the Johns Hopkins University Center for Inherited Disease Research, was provided by the National Eye Institute (X01HG005259).

  Study phs000238

• Head and neck tumor organoid biobank for modelling individual responses to radiation therapy according to the TP53/ HPV status

  Head and neck cancers (HNC) represent an extremely heterogeneous group of diseases with a poorly predictable therapy outcome. Here, we have established a comprehensive molecularly and functionally characterized head and neck organoid biobank recapitulating the clinically relevant subtypes of TP53 mutant and human papillomavirus type 16 (HPV 16) infection-driven HNC. Organoids were exposed to radiotherapy and genetically engineered normal and tumor organoids were used for testing the direct functional consequences of TP53-loss and HPV infection. We identified subtype-associated transcriptomic signatures and pathological features, including sensitivity to TP53 stabilization by the MDM2 inhibitor Nutlin-3. TP53 loss-of-function alone was insufficient to promote radiation resistance, whereas HPV 16 oncogenes E6/E7 mediated radiosensitivity via induction of cell cycle arrest.

  Study EGAS50000001219

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• The sanger result of LAM disease

  Tumor biopsies from LAM disease were analyzed by sanger to characterize the alterations in patients ,to elucidate the landscape of genetic/genomic alterations. The dataset include 21 samples.

  Dataset EGAD00010001761

• Genomic Alterations in Gingivo-buccal Cancer: ICGC-India Project_YR02

  Dataset EGAD00001001060

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Transcriptome profiling of desmoplastic small round cell tumors (DSRCTs)

  RNA sequencing of frozen resected specimens of desmoplastic small round cell tumors (DSRCTs). Four patients have specimens from multiple tissue sites included in this dataset.

  Dataset EGAD00001006388

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Aggressive genomic features in clinically indolent primary HHV8-negative effusion-based lymphoma

  Genomic profiling of effusion-based fluid samples from 8 HHV8-negative effusion-based lymphoma patients.

  Dataset EGAD00001008364

• HSP90 inhibitor resistant K562 cells

  K562 cell line has been treated with two different HSP90 inhibtors. After resistance clones emerged, they have been genetically characterized using WES in comparison to the parental K562 cell line.

  Dataset EGAD00001009051

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• Single-cell colony targeted DNAseq

  Targeted DNA sequencing was applied to colonies grown from single-cells of patient A.6. The protocol followed is described in https://doi.org/10.1038/s41467-021-21650-1 and the methods of the manuscript

  Dataset EGAD00001010193

• Chromatin profiling using Cut&Run technique of hepatoblastoma organoids

  CUT&RUN LoV-U profiling of b-catenin, LEF1 and TCF7L2 binding in biological replicates (Replicate A, Replicate B) of hepatoblastoma organoids: 10F, 13F, 13E, 17E, 22E and 135F.

  Dataset EGAD50000001749

• Development of cell lines and mouse models of bone and soft tissue sarcoma to establish novel treatment

  Malignant giant-cell tumors are extremely rare bone sarcomas that transform from conventional giant-cell tumors during long periods of treatment. We have applied the culture methods and succeeded in establishing patient-derived organoids (PDO) of rare sarcomas. This study aimed to investigate the genomic characteristics of our established novel organoids from human malignant giant-cell tumors. The developed tumors with xenograft were genomically analyzed to compare their characteristics with those of the original tumors. Genetic changes over time throughout treatment were analyzed, and the genomic status of the established organoid was confirmed. Next generation sequencing revealed that the established organoids lacked the H3-3A G34W mutation. The xenografted organoids of the malignant giant-cell tumor had phenotypes genetically similar to those of the original tumor. The established organoids were confirmed to be derived from human malignant giant-cell tumors. In summary, the present study demonstrated a novel organoid model of a malignant giant-cell tumor that was genetically confirmed to be a malignant transformed tumor. Our organoid model could be used to elucidate the molecular pathogenesis of a malignant giant-cell tumor and develop novel treatment modalities.

  Study JGAS000618

• We performed whole-exome sequencing of 20 samples (10 actinic keratosis and 10 cutaneous squamous cell carcinoma) to investigate a potential relationship between DNA methylation-based subtypes and genetic mutation patterns (Rodriguez-Paredes et al., Nat Commun 2017)

  Cutaneous squamous cell carcinoma (cSCC) is the second most common skin cancer type and arises from keratinocytes. Most cSCC progress from a UV-induced precancerous lesion termed actinic keratosis (AK). Despite various efforts to characterize these lesions molecularly, the etiology of AK and its progression to cSCC remain only partially understood. Here we have used Infinium MethylationEPIC BeadChips to interrogate the DNA methylation status of about 850.000 CpGs in epidermal preparations from healthy skin, AK and cSCC. Importantly, we found that the premalignant AK samples displayed classical features of cancer methylomes and were highly similar to cSCC methylomes. Further analysis identified typical features of stem cell methylomes, such as a reduced DNA methylation age, non-CpG methylation and stem cell-related keratin and enhancer methylation patterns. Interestingly, this signature was detected only in one half of the AK and cSCC samples, while the other half showed keratin and enhancer methylation patterns that were more closely related to the control epidermis. These findings suggest the existence of two distinct subclasses of AK and cSCC that originate from distinct keratinocyte differentiation stages.

  Study EGAS00001002670

• TRACERx Renal 100

  Evolutionary dynamics of clear cell renal cell carcinoma (ccRCC) have not been studied prospectively or across all disease stages. Through the multi-centre prospective cohort study, Renal TRACERx Renal, we analysed 1209 primary tumour regions from 101 patients with ccRCC. We detect up to 30 driver events in a single tumour, and show that subclonal diversification is associated with known clinical parameters. Defining driver event co-occurrence, mutual exclusivity and timing at clone level, we reveal deterministic patterns of clonal evolution and disease progression. We find that ccRCC can be grouped into seven distinct evolutionary subtypes, ranging from tumours characterised by early fixation of multiple mutational and copy number driver events that can disseminate widely and rapidly; to highly branched tumours with >10 subclonal drivers and extensive parallel evolution presenting with oligometastatic disease. We identify either heterogeneity or chromosome instability, or both, as determinants of patient outcome. Our insights reconcile the variable clinical behaviour of ccRCC and the benefit of surgical intervention in early and late-stage disease; and offer potential biomarker opportunities to maximise the benefit of both surgery and active surveillance.

  Study EGAS00001002793

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Gastric_Organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001003151

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Pancreatic_Organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001003520

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__organoid_control_WGS

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005449

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007602

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007604

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Mutagen_treated_organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001004873

• The impact of BNT162b2 mRNA vaccine against SARS-CoV-2 on adaptive and innate immune responses

  The mRNA-based BNT162b2 protects against severe disease and mortality caused by SARS-CoV-2 through induction of specific antibody and T-cell responses. Much less is known about its broad effects on immune responses against other pathogens. In the present study, we investigated the specific adaptive immune responses induced by BNT162b2 vaccination against various SARS-CoV-2 variants, as well as its effects on the responsiveness of human immune cells upon stimulation with heterologous viral, bacterial, and fungal pathogens. BNT162b2 vaccination induced effective humoral and cellular immunity against SARS-CoV-2 that started to wane after six months. We also observed long-term transcriptional changes in immune cells after vaccination, as assessed by RNA sequencing. Additionally, vaccination with BNT162b2 modulated innate immune responses as measured by the production of inflammatory cytokines when stimulated with various microbial stimuli other than SARS-CoV-2, including higher IL-1/IL-6 release and decreased production of IFN-α. Altogether, these data expand our knowledge regarding the overall immunological effects of this new class of vaccines and underline the need of additional studies to elucidate their effects on both innate and adaptive immune responses.

  Study EGAS00001006818

• Massively parallel functional dissection of schizophrenia associated non-coding genetic variants

  Schizophrenia (SCZ) is a severe mental disorder affecting 1% of the world population. SCZ is characterized by an underlying genetic architecture that is highly polygenic. Genome wide association studies have identified thousands of genetic variants that are statistically linked to the disease. However, the translation of these associations into insights on the pathomechanisms has been challenging because the causal genetic variants, their molecular function, and their target genes remain largely unknown. To address these questions, we combined induced pluripotent stem cell technology with a massively parallel variant annotation pipeline (MVAP) to functionally characterize 35,000 SCZ associated non-coding genetic variants. This approach identified a set of 620 (1.7%) single nucleotide polymorphisms as functional on the molecular level in a highly cell type and condition specific fashion. Subsequent multi-modal integration of epigenomic data combined with CRISPR screening in human neurons enabled us to systematically translate SCZ variant associations into target genes, biological processes, and ultimately alterations of neuronal physiology. These results provide a new high-resolution map of functional variant-gene combinations and offer comprehensive biological insights into the developmental context and stimulus dependent molecular processes modulated by SCZ genetic variation beyond statistical association.

  Study EGAS00001007542

• Meniere Disease Genomic Data Access Committee

  This Data Access Committee is responsible for reviewing and managing data access requests related to genomic variant files from whole exome sequencing of patients diagnosed with Meniere disease. This includes data from both familial and sporadic forms of the disease.

  Dac EGAC50000000708

• WGS data from COMPASS Trial

  WGS data for pancreatic cancer samples (COMPASS Trial; Knox et al., Journal of Clinical Oncology, 2025). The dataset includes tumour and normal BAM files sequenced on Illumina HiSeq/NovaSeq and aligned against GRCh38 (n=263 tumour/normal pairs).

  Dataset EGAD50000001832

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• WGS data of isogenic wild-type RPE1

  Deposited here are WGS data generated from isogenic wild-type (WT) RPE1 untreated and treated with brequinar for 42 days (and other dNTP-pool disruptor compounds)

  Dataset EGAD50000001602

• pediatric AML genomic sequences

  This dataset contains whole sequencing data from 30 patients with pediatric AML. For each patient, there is one dataset derived from tumor cells and one dataset derived from a matched non-malignant control.

  Dataset EGAD50000001572

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• scATAC-seq of sorted CD45+ cells from blood and tissues

  scATAC-seq by 10xGenomics Droplet Sequencing from two human donors. scATAC sequences are available for FACS-sorted CD45+ cells from blodd, skin and vat (visceral adipose tissue)

  Dataset EGAD50000000510

• Pacbio_methylation_controls

  The PacBio control dataset for differential methylation analysis included 39 control samples without methylation disorders. All samples were sequenced using PacBio Revio® HiFi reads at a matched coverage of 15X, and methylation was called using pb-cpg-tools on aligned BAM files.

  Dataset EGAD00010002806

• Genotype data for African Esophageal squamous cell cancer cases and controls from South Africa

  This dataset contains the cleaned genotype data from 2173 African eosphageal squamous cell cancer cases and population controls. The genotype data was generated using the H3Africa Illumina Custom microarray.

  Dataset EGAD00010002575

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716