17510 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 79.12 milliseconds.

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__organoid_control_WGS

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005449

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007602

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007604

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Mutagen_treated_organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001004873

• The impact of BNT162b2 mRNA vaccine against SARS-CoV-2 on adaptive and innate immune responses

  The mRNA-based BNT162b2 protects against severe disease and mortality caused by SARS-CoV-2 through induction of specific antibody and T-cell responses. Much less is known about its broad effects on immune responses against other pathogens. In the present study, we investigated the specific adaptive immune responses induced by BNT162b2 vaccination against various SARS-CoV-2 variants, as well as its effects on the responsiveness of human immune cells upon stimulation with heterologous viral, bacterial, and fungal pathogens. BNT162b2 vaccination induced effective humoral and cellular immunity against SARS-CoV-2 that started to wane after six months. We also observed long-term transcriptional changes in immune cells after vaccination, as assessed by RNA sequencing. Additionally, vaccination with BNT162b2 modulated innate immune responses as measured by the production of inflammatory cytokines when stimulated with various microbial stimuli other than SARS-CoV-2, including higher IL-1/IL-6 release and decreased production of IFN-α. Altogether, these data expand our knowledge regarding the overall immunological effects of this new class of vaccines and underline the need of additional studies to elucidate their effects on both innate and adaptive immune responses.

  Study EGAS00001006818

• Massively parallel functional dissection of schizophrenia associated non-coding genetic variants

  Schizophrenia (SCZ) is a severe mental disorder affecting 1% of the world population. SCZ is characterized by an underlying genetic architecture that is highly polygenic. Genome wide association studies have identified thousands of genetic variants that are statistically linked to the disease. However, the translation of these associations into insights on the pathomechanisms has been challenging because the causal genetic variants, their molecular function, and their target genes remain largely unknown. To address these questions, we combined induced pluripotent stem cell technology with a massively parallel variant annotation pipeline (MVAP) to functionally characterize 35,000 SCZ associated non-coding genetic variants. This approach identified a set of 620 (1.7%) single nucleotide polymorphisms as functional on the molecular level in a highly cell type and condition specific fashion. Subsequent multi-modal integration of epigenomic data combined with CRISPR screening in human neurons enabled us to systematically translate SCZ variant associations into target genes, biological processes, and ultimately alterations of neuronal physiology. These results provide a new high-resolution map of functional variant-gene combinations and offer comprehensive biological insights into the developmental context and stimulus dependent molecular processes modulated by SCZ genetic variation beyond statistical association.

  Study EGAS00001007542

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• The sanger result of LAM disease

  Tumor biopsies from LAM disease were analyzed by sanger to characterize the alterations in patients ,to elucidate the landscape of genetic/genomic alterations. The dataset include 21 samples.

  Dataset EGAD00010001761

• Genomic Alterations in Gingivo-buccal Cancer: ICGC-India Project_YR02

  Dataset EGAD00001001060

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Transcriptome profiling of desmoplastic small round cell tumors (DSRCTs)

  RNA sequencing of frozen resected specimens of desmoplastic small round cell tumors (DSRCTs). Four patients have specimens from multiple tissue sites included in this dataset.

  Dataset EGAD00001006388

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026