17084 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 62.84 milliseconds.

• Transcriptome profiling of three giant cell tumour of bone cell lines

  Transcriptome profiling of three established giant cell tumour of bone (GCTB) cell lines on the BGISEQ-500 platform (PE100). Cell lines consist of neoplastic "stromal" cells harboring a heterozygous H3F3A p.G34W mutation. Data was used in a study (Venneker et al., Histone deacetylase inhibitors as a therapeutic strategy to eliminate neoplastic “stromal” cells from giant cell tumors of bone, 2022) to determine H3F3A-WT/MT expression ratios, to identify pathogenic variants, and to examine the expression levels of epigenetic modifiers and regulators.

  Study EGAS00001006441

• Human pan-cancer plasma cfRNA study - raw data

  This study contains mRNA capture sequencing data from plasma of 266 different human donors. The first, pan-cancer, cohort covers 25 high-grade to metastatic cancer types (8 cancer patients per type) and a control group (8 healthy donors). The validation cohort comprises additional plasma samples from ovarian, prostate and uterine cancer patients (12 per type) as well as additional samples from controls (22 new and 8 repeated). Samples were sequenced on a NovaSeq 6000 and are provided in FASTQ format.

  Study EGAS00001006755

• Whole Genome Sequencing Data of High Grade Serous Ovarian Cancer

  Longitudinal whole genome sequencing data to study chemoresponse in ovarian cancer. These samples belong to an ongoing sample collection and the data already includes hundreds of samples from over 200 patients. Samples are from primary and metastatic tissues and ascites. All patients have been treated with platinum-taxane based chemotherapy and majority of them are diagnosed with high-grade serous ovarian cancer.

  Study EGAS00001006775

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105