16139 results for "free fc coins and points Visit Buyfc26coins.com Alennukset toistuvista ostoista..p4v2"

in 24.56 milliseconds.

• Lung cancer, healthy control and non-cancerous plasma cfDNA samples

  The dataset contains 106 lung cancer, 12 healthy control and 11 non-cancerous lesion plasma cfDNA sample. Shallow WGS was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD00001008321

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Single-cell antibody-derived tag sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell antibody-derived tag sequencing (scADT-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007017

• Follow_up_for_second_tier_signals_from_the_arcOGEN_GWAS

  The arcOGEN UK nationwide consortium has been funded by the arc to undertake a genome-wide association scan in osteoarthritis. GWA genotyping has been carried out at the Sanger on the illumina 610k array. This replication study was desinged to follow-up second-tier signals from the arcOGEN GWS in 25 SNPs (1Sequenom iPLEX) with p<5x10^-6 on 6000 additional UK OA and control samples.

  Study EGAS00001001017

• Temporal Lobe Epilepsy and Retrotransposons

  Idiopathic (cryptogenic) epilepsy is a common, chronic group of brain disorders, affecting 1-2% of the US population, creating a significant public health problem because of the associated morbidity and mortality. One subtype of this complex group of brain disorders, temporal lobe epilepsy (TLE), is particularly burdensome, because a substantial fraction of patients do not respond to anticonvulsant medications. If the seizure focus can be localized by imaging and/or EEG, the TLE patient often elects to have a partial resection of the affected temporal lobe, because they have daily seizures, despite multiple pharmacotherapy regimens. Although genetic risk is thought to play a role in TLE, identification of common risk alleles has had limited success. In the past 5 years, data have accumulated to prove that neuronal embryogenesis is accompanied by activation of LINE1 (L1) retrotransposons (RTPs) to an unexpected degree, such that developing neurons may accumulate de novo L1 insertions. This results in a substantial mosaicism within populations of CNS neurons. While most of these somatic de novo L1s will have little effect on neuronal function (perhaps because they occur in gene deserts or in large introns or in genes not required for that cell's function), some may interfere with normal neuronal activity because they have inserted into a gene needed by that particular neuron for normal function. If one or more functional de novo L1s occur early in CNS development, all the daughter neurons that derive from that neuronal precursor will also carry the L1 insertion, perhaps leading to a dysfunctional population of neurons destined to become an epileptic focus. This study leveraged CNS tissue (obtained at craniotomy) from patients with intractable TLE, who have undergone a therapeutic partial resection of one temporal lobe. Using fluorescence-assisted cell sorting of temporal lobe neuronal nuclei, followed by high-throughput sequencing and alignment to the reference genome, detection of de novo L1s will be done. In this manner, it is expected that de-novo intragenic L1s, contributing to idiopathic TLE, will be discovered.

  Study phs002067

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• CRC cell line RNA-seq

  RNA-Seq data for C32, CACO2, CL11, HT29, SW403, SW948 MSS CRC cell lines and HCEC-1CT normal colon cell line

  Dataset EGAD50000000297

• 16SV4 ribosomal RNA gene sequencing data

  16SV4 ribosomal RNA gene sequencing data of GI samples and associated mixed community cultures collected from pediatric patients at risk for IBD.

  Dataset EGAD50000000485

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• WGS of PDO in depleted media

  Whole genome sequencing profiling of 7 PDAC patient-derived organoids (PDO) grown in a culture medium lacking both WNT3A and RSPO1- WGS unmapped reads, sequenced using NovaSeq 6000, 15x coverage 160 million reads per sample.

  Dataset EGAD50000000282

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• South African breast cancer GWAS genotype data in VCF format

  South African breast cancer GWAS genotype data for 2823 female African breast cancer cases. The data was generated using the H3Africa Custom microarray and genotyped on the Illumina HiScan instrument. The dataset is in VCF format.

  Dataset EGAD00010002732

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• pediatric AML genomic sequences

  This dataset contains whole sequencing data from 30 patients with pediatric AML. For each patient, there is one dataset derived from tumor cells and one dataset derived from a matched non-malignant control.

  Dataset EGAD50000001572

• Spatial transcriptomics analysis of triple negative breast cancers

  Spatial transcriptomics analysis of triple negative breast cancers Both bulk sequencing and ST were performed Counts, images etc are available at https://zenodo.org/doi/10.5281/zenodo.8135721

  Dataset EGAD50000000686

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Clinical Utility of BRCA Research by Inocras, CMC and SMC (CUBRICS)

  This dataset consists of transcriptome data available for most cases of the whole-genome sequences from 1,364 Korean breast cancers

  Dataset EGAD50000001993

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• MDA whole exome sequencing data for bladder cancer

  46 BAM files from 23 urothelial bladder cancer patients on an immunotherapy clinical trial. PBMC normal samples and solid tumor samples are paired. Alignment was done by BWA with reference genome hg19.

  Dataset EGAD00001005712

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• ADAPTeR Study: scRNA/TCRseq data from ccRCC patients

  ADAPTeR study scRNA and scTCR data from TILs from two ccRCC patients treated with nivolumab

  Dataset EGAD00001008166

• HV31 - 10x linked-read sequencing

  10x linked-read sequencing data for individual HV31 generated using DNA from CD14+ monocytes, to a sequencing depth of ~40×. Sequencing was performed at Bart’s and the London Genome Centre on the Illumina HiSeq platform.

  Dataset EGAD00001007046

• Whole-exome sequencing (WES) data of papillary thyroid cancer and adjacent normal tissues

  High-coverage WES sequencing of DNA samples from 50 PTCs was performed on the Illumina HiSeq 2500 or 4000 System

  Dataset EGAD00001003262

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• WGS, RNA-seq and methyl-seq data for multiple tumour clones from a single glioblastoma case.

  10 bams of WGS data from HiSeqXTen platform; 10 bams of RNA-seq data from HiSeq2500 platform; 7 bams of TruSeq Methyl Capture EPIC sequencing data from HiSeq4000 platform

  Dataset EGAD00001004773

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Strand-specific RNA sequencing of 16 pairs of primary and relapsed IDH-wt glioblastomas

  This dataset contains strand-specific RNA sequencing data from 16 primary/relapsed sample pairs of IDH-wt glioblastomas

  Dataset EGAD00001004564

• Chondromyxoid fibroma

  Chondromxoid fibroma is a benign tumour of bone with unknown underlying pathogenesis. To determine pathognomic genomic event in chondromyxoid fibroma whole genome sequencing will be undertaken to reconstruct rearrangements and find underlying mutations.

  Dataset EGAD00001001063