10984 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 22.37 milliseconds.

• Exploration of coding and non-coding variants in cancer using GenomePaint.

  GenomePaint (https://proteinpaint.stjude.org/genomepaint) is a dynamic visualization platform for whole-genome, whole-exome, transcriptome, and epigenomic data, featuring a novel design that captures the inter-relatedness between DNA variations and RNA expression. Regulatory non-coding variants can be inspected and discovered along with coding variants, and their functional impact further explored by examining 3D genome and/or ChIP-seq data generated from cancer cell lines. Further, GenomePaint correlates mutation and expression patterns with patient outcomes, and can display external data such as adult cancer datasets and user-provided custom tracks. We used GenomePaint to analyze multi-omics data from 3,652 pediatric cancers representing 16 histotypes, and demonstrate the visualization features through examples, including two that led to new insights into oncogenic mechanisms in pediatric cancer. The first is the discovery of a new class of pathogenic recurrent variants that cause aberrant splicing, disrupting the RING domain of CREBBP, a driver gene frequently mutated in relapsed pediatric leukemia. The second is the cis-activation of the MYC oncogene in a subset of B-lineage acute lymphoblastic leukemia (B-ALL) via duplication of the NOTCH1-MYC enhancer (N-ME), previously discovered only in T-lineage ALL. The regulatory impact of N-ME enhancer amplification was initially confirmed by allelic imbalance in published gene expression and ChIP-seq data and verified by additional Capture-C and fluorescence in situ hybridization data generated by follow-up experiments. These examples demonstrate the power of GenomePaint in enabling not only data visualization but also integrative genomic analysis that can lead to novel biological insight for follow-up experimental validation.

  Study EGAS00001004669

• Analysis of T-cell receptor clonotypes in tumor micro-environment identifies shared cancer type-specific signatures

  Despite the conventional view that a truly random V(D)J recombination process should generate a highly diverse immune repertoire, emerging reports suggest that there is a certain bias towards the generation of shared/public immune receptor chains. These studies were performed in viral diseases where public T-cell receptors (TCR) appear to confer better protective responses. Selective pressures generating common TCR clonotypes are currently not well understood but it is believed that they confer a growth advantage. As very little is known about public TCR clonotypes in cancer, here we set out to determine the extent of shared TCR clonotypes in the intra-tumor microenvironments of virus- and non-virus- driven head and neck cancers using TCR sequencing. We report that tumor-infiltrating T-cell clonotypes were indeed shared across individuals with the same cancer type, where the majority of shared sequences were specific to the cancer type (ie viral versus non-viral). These shared clonotypes were not particularly enriched in EBV-associated nasopharynx cancer, but in both cancers, exhibited distinct characteristics, namely shorter CDR3 lengths, restricted V- and J-gene usages and also demonstrated convergent V(D)J recombination. Many of these shared TCRs were expressed in patients with a shared HLA background. Pattern recognition of CDR3 amino acid sequences revealed strong convergence to specific motifs that were unique to each cancer type, suggesting they may be enriched for specificity to common antigens found in the tumor microenvironment. The identification of shared TCRs in infiltrating tumor T-cells not only adds to our understanding of the tumor adaptive immune recognition but could also serve as disease-specific biomarkers and guide the development of future immunotherapies.

  Study EGAS00001005480

• Genetic heritage of the Baphuthi highlights an over-ethnicised notion of 'Bushman' in the Maloti-Drakensberg, southern Africa

  Using contemporary people as proxies for ancient communities is a contentious but necessary practice in anthropology. In southern Africa, the distinction between the Cape KhoeSan and eastern KhoeSan remains unclear as ethnicity labels have been changed through time and most communities were decimated if not extirpated. The eastern KhoeSan may have had genetic distinctions from neighbouring communities who speak Bantu languages and KhoeSan further away, alternatively the identity may not have been tied to any notion of biology, instead denoting communities with a nomadic 'lifeway' distinct from African agro-pastoralism. The Baphuthi of the 1800s in the Maloti-Drakensberg, southern Africa had a substantial KhoeSan constituency and a lifeway of nomadism, cattle raiding, and horticulture. Baphuthi heritage could provide insights into the history of the eastern KhoeSan. We examine genetic affinities of 23 Baphuthi to discern whether the narrative of KhoeSan descent reflects distinct genetic ancestry. Genome-wide SNP data (Illumina GSA) were merged with 52 global populations, for 160K SNPs. Genetic analyses show no support for a unique eastern KhoeSan ancestry distinct from other KhoeSan or southern Bantu-speakers. The Baphuthi have strong affinities with early-arriving southern Bantu-speaking (Nguni) communities, as the later-arriving non-Nguni show strong evidence of recent African admixture possibly related to Late-Iron Age migrations. The references to communities as 'San',and 'Bushman' in historic literature has often been misconstrued as notions of ethnic/biological distinctions. The terms may have reflected ambiguous references to non-sedentary polities instead, as seems to be the case for the eastern ‘Bushman’ heritage of the Baphuthi.

  Study EGAS00001007080

• Women's Health Initiative Clinical Trial and Observational Study - Imaging

  Objectives: The clinical trial assessed the safety and efficacy of three interventions. Specifically, it evaluated (1) the major health benefits and risks of estrogen plus progestin and estrogen alone, (2) the effects of a low-fat eating pattern on risk of colorectal cancer, and (3) the efficacy of calcium with vitamin D supplementation for preventing hip and other fractures. The objective of the memory study was to determine whether estrogen plus progestin therapy protects global cognitive function, and evaluate the therapy's effect on the incidence of dementia and mild cognitive impairment.The observational study is examining the relationship between lifestyle, socioeconomic, health, and other risk factors with cardiovascular, breast cancer, colorectal cancer and osteoporotic fracture outcomes. Secondary objectives include providing more reliable estimates of the extent to which known risk factors predict disease, more precise estimates of new occurrences of disease, and to provide a future resource for the identification of new or novel risk factors especially factors found in blood. Background: The Women's Health Initiative (WHI) is a long-term national health study that has focused on strategies for preventing the major causes of death, disability, and frailty in postmenopausal women, specifically heart disease, cancer, and osteoporotic fractures. The WHI is primarily composed of an observational study (OS), as well a clinical trial (CT) with three components: Hormone Replacement Therapy (HT), Dietary Modification, (DM) and Calcium/Vitamin D supplementation (CaD).Prior to the WHI, observational studies suggested that postmenopausal hormone therapy was associated with a decreased risk of coronary heart disease (CHD). Potential cardioprotection was based on generally supportive data on lipid levels in intermediate outcome clinical trials, trials in nonhuman primates, and a large body of observational studies suggesting a 40% to 50% reduction in risk among users of either estrogen alone or, less frequently, combined estrogen and progestin. Observational studies primarily examining unopposed estrogen preparations have suggested a 30% to 50% reduction in coronary events, and an 8% to 30% increase in breast cancer with extended use. Other research findings indicated that hormone therapy was also associated with a decreased risk of osteoporosis and increased bone density. The WHI HT trials were designed to test the effects of postmenopausal hormone therapy on risk for coronary heart disease and assess overall risks and benefits in predominantly healthy women. The Women's Health Initiative Memory Program (WHIMS) consists of a suite of studies which include cohorts of women who participated in the WHI HT trials. Postmenopausal women have a greater risk than men of developing Alzheimer's disease, but studies of the effects of estrogen therapy on Alzheimer's disease have been inconsistent. Additionally, observational studies have suggested that postmenopausal hormone treatment may improve cognitive function, but data from randomized clinical trials have been sparse and inconclusive. International comparisons and migration studies have suggested that countries with 50% lower fat intake than the US population had approximately one third the risk of colorectal cancer. Additionally, fairly consistent evidence existed for an effect of dietary fat, vegetables and fruits, and grains on colorectal cancer risk from within-country observational studies, although the protective effect of lower fat intake was no longer clear after adjusting for energy intake. The WHI DM trial was the first randomized trial to directly address the health effects of a low-fat eating pattern in predominantly healthy postmenopausal women from diverse racial/ethnic, geographic, and socioeconomic backgrounds. Osteoporosis is a major cause of injury, loss of independence, and death, and contributes to hip fractures. Observational evidence and data from previous randomized clinical trials suggest that calcium and/or vitamin D supplements may slow bone loss and reduce the risk of falls in postmenopausal and elderly women. However, evidence from trials, observational studies, and meta-analyses of calcium and vitamin D supplementation with respect to hip and other fractures was limited at the time the WHI was initiated. In two prior randomized trials, calcium plus vitamin D supplements did not reduce the risk of nonvertebral fractures among older women. When the WHI CaD trial was designed, guidelines recommended daily intakes of 800 to 1200 mg of calcium with 400 IU of vitamin D for the prevention of osteoporosis, which was not met by many American women. Therefore, the WHI CaD trial was designed to test the primary hypothesis that postmenopausal women randomly assigned to calcium plus vitamin D supplementation would have a lower risk of hip fracture and, secondarily, of all fractures than women assigned to placebo. Subjects: Postmenopausal women ages 50 to 79 were eligible to participate. A woman was considered postmenopausal if she had experienced no vaginal bleeding for 6 months (12 months for women under 55 years of age), had had a hysterectomy, or had ever used postmenopausal hormones. Recruitment was carried out in 40 US clinical centers in 1993-1998. The clinical trial components had additional specific inclusion or exclusion criteria.A total of 68,132 women were randomized into at least one component of the clinical trial. 27,347 women were enrolled in the hormone therapy component with 16,608 in the estrogen plus progestin trial and 10,739 in the unopposed estrogen trial, 48,835 women were enrolled in the diet modification component, and 36,282 women were enrolled in the calcium/vitamin D component. 7,479 women 65 years of age and older at baseline and that participated in the HT trial component were enrolled in the ancillary memory study. Women who were either ineligible or unwilling to participate in the clinical trial component were enrolled in the observational study. For example, many potential participants to the clinical trial component of the study were already undertaking a low fat diet or were using hormone replacement therapy. The effect of the selection process was that women enrolled in the observational study tended to have healthier lifestyles compared to those enrolled in the clinical trial. In total, 93,676 subjects were enrolled in WHI OS, with over 16% being members of a racial/ethnic minority group. The first WHI Extension Study enrolled 115,407 consenting participants from all components of the original WHI study for an additional five years of follow-up, from 2005 to 2010. In 2010, 93,567 women consented to continued follow-up. Design: The clinical trial component of the WHI included three randomized comparisons: hormone therapy, dietary modification, and calcium/vitamin D supplementation. Women could have been randomized into one, two or all three trials.The hormone therapy trial enrolled women to one of two double-blinded trials: estrogen (0.625 mg of conjugated equine estrogens daily) plus progestin (2.5 mg of medroxyprogesterone acetate daily) or estrogen alone. Women with a prior hysterectomy were eligible for the trial of unopposed estrogen. Women with an intact uterus at screening were initially also eligible for unopposed estrogen, but were reassigned to the trial of combined postmenopausal hormones beginning in 1995. Both trials randomized participants 1:1 to either hormone therapy or placebo. A 3-month washout period was required before baseline evaluation of women using postmenopausal hormones at initial screening. Study participants were contacted by telephone 6 weeks after randomization to assess symptoms and reinforce adherence. Follow-up contacts by telephone or clinic visit occurred every 6 months, with clinic visits required annually. The estrogen plus progestin trial was halted in July 2002 after a mean 5.2 years of follow-up because health risks, including increased risk of breast cancer and cardiovascular disease, exceeded benefits. The estrogen alone trial was stopped early in March 2004, because an increased risk of stroke was found with no benefit for coronary heart disease. The primary outcome was coronary heart disease (CHD) (nonfatal myocardial infarction and CHD death), with invasive breast cancer as the primary adverse outcome. The dietary modification trial evaluated the effect of a low-fat, high fruit, vegetable, and grain diet on preventing cardiovascular disease and cancer. Participants were randomly assigned to an intervention or a comparison group in the ratio of 2:3 for cost-efficiency. The intervention was an intensive behavioral modification program, using 18 group sessions in the first year and quarterly sessions thereafter, led by specially trained and certified nutritionists. The program was designed to promote dietary change with the goals of reducing total fat to 20% of energy intake, increasing vegetables and fruits to at least 5 servings daily and grains to at least 6 servings daily. The intervention did not include total energy reduction or weight loss goals. Comparison group participants received a copy of the US Department of Health and Human Services' Dietary Guidelines for Americans and other health-related materials but were not asked to make dietary changes. Dietary intake was monitored using the WHI food frequency questionnaire at 1 year and in a rotating one-third subsample every year thereafter. Women completed a medical update questionnaire every 6 months, and medical records were sought for all women reporting colorectal cancer. The primary outcome was invasive colorectal cancer incidence. Participants in the calcium/vitamin D trial were randomized 1:1 to either supplements or placebo. Active tablets contained 500 mg of elemental calcium (as calcium carbonate) and 200 IU of vitamin D3, to be taken twice daily with meals. The presence and severity of symptoms, safety concerns, and outcomes were ascertained at annual clinic visits and telephone or clinic visits at intervening six-month intervals. Risk factors for fracture were assessed by questionnaire, interview, and clinical examination. The primary outcome was incidence of hip fracture. Participants in the observational study attended a baseline examination and were re-examined three years later. Participants completed annual updates of exposures and clinical outcomes by mail. Final data were collected by mail during the close-out period in April 2004 to March 2005. The major clinical outcomes of interest were coronary heart disease, stroke, breast cancer, colorectal cancer, endometrial cancer, ovarian cancer, osteoporotic fractures, diabetes, and total mortality. Most outcomes were initially ascertained by self-report on an annual questionnaire and documented by hospital and related records. Charts with potential cardiovascular, cancer, and fracture outcomes were sent to the local physician adjudicator for evaluation and classification. Staff at the Clinical Coordinating Center coded and adjudicated all cancers of major interest in the study using standardized SEER guidelines. In 2005, WHI participants were invited to join the Extension Study for an additional five years of follow-up in order to collect long-term outcomes. Participants completed annual data collection forms primarily by mail, similar to the OS follow-up. Women reporting study outcomes were contacted by WHI field center staff to obtain additional details and medical records, which were evaluated by physician adjudicators. In 2010, the woman remaining were invited to join the next Extension Study. In the second extension, women were divided into two groups, one of which would have outcomes documented with medical records (the Medical Records Cohort, MRC), and the other would just be followed by self-report (the Self-Report Cohort, SRC). The MRC consists of women who were in the hormone therapy trials, and all African-American and Hispanic women. In 2012-2013, a subset of the MRC was identified for a potential in-home visit to collect blood and several objective measures of physical functioning. Conclusions: Overall health risks exceeded benefits from use of combined estrogen plus progestin after an average 5.2 year follow-up among healthy postmenopausal US women (Rossouw et al., 2002, PMID:12117397). Among postmenopausal women aged 65 years or older, estrogen plus progestin did not improve cognitive function when compared with placebo (Rapp et al., 2003, PMID: 12771113), increased the risk for probable dementia, and did not prevent mild cognitive impairment (Shumaker, et al., 2003, PMID: 12771112). The use of conjugated equine estrogen increased the risk of stroke, decreased the risk of hip fracture, and did not affect CHD incidence in postmenopausal women with prior hysterectomy after an average of 6.8 years of follow-up (Anderson et al., 2004, PMID: 15082697). Over approximately 8 years of follow-up, a low-fat dietary pattern did not reduce the risk of colorectal cancer (Beresford, et al., PMID: 16467233). Calcium with vitamin D supplementation resulted in a small but significant improvement in hip bone density; however, no significant difference was observed in hip fractures (Jackson, et al., 2006, PMID: 16481635). A recent review summarizes the conclusions from the WHI clinical trials with a focus on clinical practice (Manson, et al., 2024, PMID: 38691368).Description of ECG Imaging Data: Electric cardiograms (ECGs) were given to all clinical trial participants at baseline and in years 3, 6, and 9 of the original WHI study.EKG data consist of 12 lead 10 seconds ECGS sampled at 500Hz via GE ECG machines and process via GE MUSE system. The ECG waveform were directly exported from GE MUSE using MUSE export function in XML format, which include EKG waveform data as well as other ECG characteristics. Waveform data is in base64 encoded format, when it is decoded, it is a binary data that can be used to draw waveform graph. Many programming languages and data tools have built in functions to decode base64 strings. All the other necessary information is included in the LeadData section, total byte size, total sample size etc. (usually 1 sample is 2 bytes). See example below: encoded-data (base64 encoded string) JwAoAC0AKAAiACIAJAAkACQAIwAiACIAHgAcABwAGwAZABgAGAAYABcAEwAQABAAEAAL^/AAsADAAM... decoded-binary-data (1 sample is 2 bytes) 270028002D002800220022002400240024002300220022001E001C001C001B00 1900180018001800170013001000100010000B000B000C000C000D000D000D00 0A000A000A0009000600040004000700070005000500020... These binary values are integers (Y axis data of the graph), hence it is a straightforward process to draw the waveform graph. Acquisition dates have been redacted from this ECG data to comply with WHI policy. All acquisition dates within files and in file names have been set to January 1, 1900 (19000101) to comply with this policy.

  Study phs003824

• A Genome-Wide Association Study of Heroin Dependence

  This collaboration of Australian and American investigators aims to identify genes associated with liability for heroin dependence. The project uses a case-control design in which cases met lifetime DSM-IV criteria for heroin dependence. Controls included assessed individuals who did not meet DSM-IV heroin dependence criteria and unassessed general population controls. Cases and controls were obtained from the several large investigations including: The Comorbidity and Trauma Study, Heroin Dependence in Western Australia, the OZ-ALC Study, a Twin Study of Mole Development in Adolescence, and ongoing genetic studies of substance dependence conducted by investigators at Yale and collaborating institutions. These projects are briefly described below. The Comorbidity and Trauma Study (PI: Elliot Nelson), a retrospective case-control study examining genetic and environmental factors contributing to heroin dependence liability. The study was funded by the National Institute on Drug Abuse (NIDA), and was run in collaboration with Washington University, the Queensland Institute of Medical Research (QIMR), and the National Drug and Alcohol Research Centre (NDARC), University of New South Wales. Case participants were recruited from maintenance clinics in the greater Sydney area. Control participants were recruited from employment centres and community centres, open street malls, and local press servicing the same geographical area as the opioid maintenance treatment clinics and either denied recreational use of opioids or had used these drugs recreationally fewer than 11 times lifetime. The prevalence in these individuals of non-opioid licit drug dependence and illicit drug dependence as well as childhood trauma exposure and other psychiatric disorders is elevated considerably versus estimates of similar measures in Australian general population samples. Participants provided blood samples as a source of DNA and completed a comprehensive psychiatric diagnostic interview based on the Semi-Structured Assessment of the Genetics of Alcoholism - Australia (SSAGA-OZ) augmented with sections drawn from other instruments assessing childhood trauma exposure, family history, and screening for borderline personality disorder. Heroin Dependence in Western Australia (PI: Sybille Schwab) is a study focusing both on genetic contributions to heroin dependence and response to naltrexone treatment of the disorder. Participants completed a clinical assessment and provided blood samples during their treatment at the Perth Naltrexone Clinic now name as the Fresh Start Recovery Programme. Funding for the project was provided by the Australia Government's National Health and Medical Research Council (Grant # 513862; PI: Sybille Schwab) Affected subjects from ongoing genetic studies of substance dependence conducted by investigators at Yale (PI: Joel Gelernter) and collaborating institutions were collected in the course of several NIDA-funded studies. Those included in the current set were assessed by means of the SSADDA (Semi-Structured Assessment for Drug Dependence and Alcoholism). All are opioid dependent European-Americans, and all list heroin as the opioid must used. Most were collected at Yale University School of Medicine or University of CT School of Medicine under the supervision of Drs Joel Gelernter and Henry Kranzler. Control subjects were also collected in the course of several NIDA- and NIAAA-funded studies. Those included in the current set were assessed by means of the SSADDA (Semi-structured Assessment for Drug Dependence and Alcoholism). Most were collected at Yale University School of Medicine or University of Connecticut School of Medicine under the supervision of Drs Joel Gelernter and Henry Kranzler. The OZ-ALC Study (PI: Andrew Heath) consists of a large group of twins and their family members ascertained from the general population Australian Twin Registry who have participated in ongoing research projects. For the control investigation, we have selected individuals who do meet criteria for illicit drug dependence who have had GWAS genotyping with the Illumina Human CNV370-Quad. Inclusion of individuals with alcohol dependence or nicotine dependence was minimized. For a more detailed description of the study, please see: http://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/study.cgi?study_id=phs000181.v1.p1 The Twin Study of Mole Development in Adolescence (PI: Nick Martin) is an ongoing investigation of melanocytic naevi funded by the Australian Government's National Health and Medical Research Council (Grant # 389891; PI: Nick Martin). For the current project, unassessed parents of these twins will serve as a control group. These individuals will either have been previously genotyped with the Illumina Human 610-Quad BeadChip or will be genotyped as part of the current project. Parents have largely survived the period of risk for heroin dependence and, by virtue of their participation in this research, are very likely to have a prevalence of heroin dependence lower than that in the general population (i.e., <0.7%). In order to understand the immune modulatory effect of opioids across peripheral blood immune populations, a second study (PI: Christine S. Cheng) analyzed single cell RNA-seq profiles from the PBMCs of a subset of case participants and control participants from the Comorbidity and Trauma Study (PI: Elliot Nelson). The study assessed and identified transcriptional changes between opioid dependent and control samples across naive and LPS stimulated immune populations.

  Study phs000277

• CaBagE: a Cas9-Based Background Elimination Strategy for Targeted, Long-Read DNA Sequencing

  While repeat-expansion polymorphisms are known to underlie several developmental and neurological disorders, technological limitations have inhibited the ability to resolve accurate genotypes for these variants. A pertinent example is the (CCCCGG)n repeat expansion in C9orf72 that segregates with up to 40% of familial amyotrophic lateral sclerosis (ALS) cases. There is a clear relationship between this repeat expansion and neurodegeneration. However, widely-used short-read sequencing is ill-suited to characterize the C9orf72 repeat expansion due to polymerase slippage over low complexity sequences and the inherently limited mapping/haplotype resolution of redundant short sequences. Consequently, researchers and physicians must rely on crude variant characterization methods (e.g. Southern blots), which limit direct genotype-phenotype associations and create challenges for the diagnosis of disease in patients with atypical clinical presentation. In contrast, ultra-long (e.g., 10-150kb) sequencing reads generated by Oxford Nanopore Technologies (ONT) enable direct measurement of loci containing complex structures without being subject to amplification or alignment bias. We are therefore developed a molecular and computational framework for targeted sequencing and quantification of pathogenic repeat expansions by combining Cas9 and amplification-free sequence capture methods with Nanopore long-read sequencing technology. First, extracted high molecular weight DNA is bound by Cas9 on either side of a DNA target. Bound Cas9 protects the target DNA from challenge by processive exonucleases. Unprotected (off-target) DNA is degraded with exonucleases and the remaining sample is sequenced using the ONT MinION sequencer. Then, base-called reads are aligned to the target locus and repeat copy number genotypes are estimated using a Gaussian Mixture Model. We applied this molecular and computational framework to 2 ALS patients with C9orf72 repeat expansions with biospecimens available from the NINDS collection from Coriell. Genotype estimates produced with CaBagE were commensurate with genotypes derived from repeat-primed PCR for each individual.

  Study phs002368

• Advancing Precision Oncology in a Humanized, Fully Autologous Mouse Model

  Progress in the early detection and treatment of cancer requires accurate model systems to further evaluate new, promising discoveries. Small animal and, in particular, mouse model systems are attractive to researchers for numerous reasons, including their ease of use and well-described platforms. The ability to grow human tumors in immune-deficient mice (so-called patient-derived xenografts, or PDXs) allows researchers to work directly with human cancer tissue in a controlled setting. However, PDX models are limited by their lack of an intact immune system. Immunotherapy has revolutionized clinical oncology, but lacks pre-clinical models of the human immune system and human cancer to investigate new modalities and limitations/toxicities of treatment regimens. The broad objective of this study is to validate an in vivo model to evaluate human tumors in the context of a complete and intact human immune system in a completely personalized and autologous fashion to study cancer immunotherapy. Herein, we will: (1) validate the ability of our humanized system to serve as a model for cancer immunotherapy treatment response and toxicity in patients with melanoma, including immunotherapy checkpoint blockade and vaccine strategies, and (2) extend our current work in melanoma by validating the ability to establish humanized mice and evaluate tumor growth and leukocyte development in autologous human pancreatic and colorectal tumors established in humanized mice. In each of these areas, we will leverage our multi-institutional team's individual expertise along with our institutional infrastructure to maximize the success of the experimental aims. The results from this project will be widely available to the general research community for future, hypothesis-driven research. Taken together, our study will meet multiple goals and address several unmet needs in cancer immunotherapy, thus significantly enhancing the applicability of a fully autologous and immunocompetent precision model system for use in translational oncology research.

  Study phs003090

• A Scalable, GMP-Compatible, Autologous Organotypic Cell Therapy for Dystrophic Epidermolysis Bullosa

  Gene editing in induced pluripotent stem (iPS) cells has been hailed for enabling new cell therapies for various monogenetic diseases including dystrophic epidermolysis bullosa (DEB). However, manufacturing, efficacy, and safety roadblocks have limited the development of genetically corrected, autologous iPS cell-based therapies. Dystrophic Epidermolysis Bullosa Cell Therapy (DEBCT), is a new generation, Good Manufacturing Practice-compatible (cGMP), reproducible, and scalable platform to produce autologous clinical-grade iPS cell-derived organotypic induced skin composite (iSC) grafts to treat incurable wounds of patients lacking type VII collagen (C7). DEBCT uses a single step, combined, high-efficiency reprogramming, and CRISPR-based genetic correction to generate genome scar-free, COL7A1 corrected clonal iPS cells from primary patient fibroblasts. Validated iPS cells are converted into epidermal, dermal, and melanocyte progenitors with a novel 2D organoid differentiation protocol, followed by CD49f enrichment and expansion to minimize maturation heterogeneity. iSC product characterization by single cell transcriptomics was followed by mouse xenografting for disease correcting activity at 1 month and toxicology analysis at 1-6 months. Culture-acquired mutations, potential CRISPR-off target effects, and cancer-driver variants were evaluated by targeted and whole genome sequencing. iPS cell-derived iSC grafts were reproducibly generated from four recessive DEB patients with different pathogenic mutations. Organotypic iSC grafts onto immune-compromised mice developed into stable stratified skin with functional C7 restoration. Single cell transcriptomic characterization of iSCs revealed prominent holoclone stem cell signatures in keratinocytes and the recently described Gibbin-dependent signature in dermal fibroblasts. The latter correlated with enhanced graftability. Multiple orthogonal sequencing and subsequent computational approaches identified random and non-oncogenic mutations introduced by the manufacturing process. Toxicology revealed no detectable tumors after 3-6 months in DEBCT-treated mice. In conclusion, DEBCT successfully overcomes previous roadblocks and establishes a robust, scalable, and safe cGMP manufacturing platform for the production of a CRISPR-corrected autologous organotypic skin graft to heal DEB patient wounds.

  Study phs003271

• A Sequential Window of Opportunity Trial of Anti-PD-L1/TGF-β trap (M7824) Alone and in Combination with TriAd Vaccine and N-803 for Resectable Head and Neck Squamous Cell Carcinoma not Associated with Human Papillomavirus Infection

  This submission includes the whole exome and bulk RNA sequencing associated with the correlative study of clinical specimens from a prospective clinical study of neoadjuvant bintrafusp alfa in patients with newly diagnosed, surgically resectable oral cavity or laryngeal squamous cell carcinoma. 

  Study phs002849

• Pilot study towards the development of a Companion/Complimentary Diagnosis platform using liquid biopsy with cfDNA for immune checkpoint inhibitor therapy in advanced urothelial cancer

  Preliminary analysis was conducted to develop a cfDNA-based platform capable of predicting gene mutation profiles, TMB, gene expression profiles (molecular subtype diagnosis), and immunohistochemical findings (PD-L1 expression) using the primary lesion tissue of bladder cancer and upper urinary tract epithelial cancer, verifying the feasibility of such development.

  Study JGAS000714

• The Emirati T2T-level Pangenome: A complete Diploid Graph of 58 Genomes

  This dataset is an Emirati telomere-to-telomere (T2T) pangenome graph in GBZ format built from 116 haplotype-resolved assemblies spanning 58 individuals (28 trio-based and 30 single-sample assemblies). Assemblies were generated with long-read sequencing (PacBio HiFi and ONT ultra-long) with standard polishing, then integrated into a graph representation. The genomes show high contiguity (median ≈150 Mb) and high consensus accuracy (median QV 59). The resulting GBZ graph captures globally shared and Emirati-enriched variation, including sequence in complex regions, and serves as a population-matched reference for downstream variant discovery and annotation.

  Dataset EGAD50000001756

• Targeted Illumina sequencing of 3399 plasma cfDNA samples and 1988 leukocyte DNA samples from 1995 metastatic prostate cancer patients

  Blood samples were collected from eight clinical trials and a British Columbia-based biobank. All plasma cfDNA and leukocyte DNA samples were processed with uniform methodology, and underwent targeted sequencing using a custom hybridization capture panel and Illumina instruments. Four different generations of custom hybridization capture panel were used, all providing coverage of the complete coding regions of 72 prostate cancer genes, and later panel generations also providing exhaustive coverage of the AR locus (including introns and flanking regulatory regions), as well as a genome-wide SNP grid for copy number analysis.

  Dataset EGAD50000001594

• Circulating Biomarker Laboratory within the Division of Cancer of Imperial College London

  The purpose of the Circulating Biomarker Laboratory within the Division of Cancer of Imperial College London (ICL) is to assist ICL researchers working on solid tumours or/and haematological malignancies with a particular interest in the analysis of liquid biopsies. We are focusing on isolating and analysing single circulating tumour cells (CTCs) and cell-free circulating tumour DNA (ctDNA) from cancer patients' blood samples but also pure tumour poulations from heterogeneous Formalin-fixed paraffin-embedded (FFPE) tissue specimens with a view to monitoring tumour-related changes, such as mutations and copy number alterations at a single cell level.

  Dac EGAC50000000768

• Bleomycin Induced Pneumonitis WGS dataset

  This is whole genome sequencing data from a cohort of 18 patients with germ cell tumours or Hodgkin Lymphoma, who developed clinically significant bleomycin-induced pneumonitis despite low clinical risk. DNA was extracted from whole blood, and 150-base paired-end reads were generated on an Illumina NovaSeq 6000 instrument to a minimum 30x depth. Sequence reads were aligned to the GRCh38 reference with BWA MEM, and germline variants were called following GATK best practice procedures. The dataset comprises per-sample read alignment files in BAM format, and a joint-called germline variant file in VCF format.

  Dataset EGAD50000002221

• Transcriptomic data of a discordant monozygotic twin pair for ALS

  The dataset contains bulk RNAseq data of a discordant monozygotic twin pair for ALS; in particular the matrix with gene names and TPM counts for each sample. For both healthy and ALS twin, RNA sequencing was performed on RNA samples collected at two different time points (T1 and T2), for a total of seven samples. RNA extracted from PBMCs was used for library preparation according to Illumina TruSeq Stranded mRNA kit and processed on Illumina NextSeq 550 sequencer. Reads were aligned to the reference human genome GRCh38/hg38 and annotations were provided by the Ensembl v100 database.

  Dataset EGAD50000001330

• SCLC study George et al. - RNA-sequencing data set

  RNA-sequencing (RNA-seq) was performed with RNA extracted from fresh-frozen human tumor tissue samples. cDNA libraries were prepared from poly-A selected RNA applying the Illumina TruSeq protocol for mRNA. The libraries were then sequenced with a 2 x 100bp paired-end protocol to a minimum mean coverage of 30x of the annotated transcriptome.

  Dataset EGAD00001001244

• Three large nuclear families in which a single child per family was diagnosed with cancer

  We collected saliva samples from three nuclear families having 4, 5, and 7 children, respectively. One child in each nfamily had been diagnosed with a pediatric tumor, and neither parent had been diagnosed with cancer. Diagnoses included Wilms tumor, low-grade astrocytoma, and Burkitt’s lymphoma, respectively. We used whole-genome sequencing to profile normal cells from each family member and a linked-read technology.

  Dataset EGAD00001007709

• Cardiogenics_Custom_Pools - Agilent SureSelect

  The Cardiogenics re-sequencing study will consist of three parts: Eight pools of 25 individuals will be sequenced using a Nimblegen hybrid-capture solution specific to miRNA sequences, 80 pools of 25 individuals will be sequenced using a custom Agilent SureSelect array covering genes associated with coronary artery disease (CAD) and myocardial infarction (MI), 10 individuals from families with a history of CAD/MI will be exome sequenced using the Sanger exome array. The experiment will use the early onset patients from the German MI cohort and the UK BHF CAD/MI cohort both of which have strong family history. For controls we will consider individuals from the UKBS and KORA cohorts.

  Dataset EGAD00001000397

• Nimblegen

  The Cardiogenics re-sequencing study will consist of three parts: Eight pools of 25 individuals will be sequenced using a Nimblegen hybrid-capture solution specific to miRNA sequences, 80 pools of 25 individuals will be sequenced using a custom Agilent SureSelect array covering genes associated with coronary artery disease (CAD) and myocardial infarction (MI), 10 individuals from families with a history of CAD/MI will be exome sequenced using the Sanger exome array. The experiment will use the early onset patients from the German MI cohort and the UK BHF CAD/MI cohort both of which have strong family history. For controls we will consider individuals from the UKBS and KORA cohorts.

  Dataset EGAD00001000398

• EHMT2 alterations cause a Kleefstra-like syndrome

  We report clinical and molecular correlates associated with six de novo EHMT2 variants identified in patients presenting with a Kleefstra syndrome–like phenotype. Transcriptomic profiling of patient-derived fibroblasts and induced pluripotent stem cells (iPSCs) reveals shared gene expression signatures between EHMT2 variant carriers and Kleefstra syndrome, compared with cell lines derived from healthy donors.

  Study EGAS50000001637

• PD1-targeted delivery of an IL-2 variant induces a multifaceted anti-tumoral T cell response in human lung cancer

  To explore PD1-IL2v-specific effects on CD8 and CD4 T cells at a transcriptomic level, we performed single-cell RNA sequencing of patient-derived tumor fragments (PDTFs) which were treated with either Isotype (DP47), Isotype-IL2v (DP47-IL2v), anti-PD1 (PembroPGLALA) or PD1-IL2v (PembroPGLALA-IL2v) for 48 hours.

  Study EGAS50000000396

• Sex Differences in MAGEL2 Gene Promoter Methylation in High Functioning Autism - Trends from a Pilot Study Using Nanopore Cas9 Targeted Long Read Sequencing

  Using DNA extracted from peripheral blood, Cas9-targeted nanopore DNA sequencing was used to analyze MAGEL2 gene, including its entire regulatory construct (chr15:23639316-23651466), for sequence variation and 5-methyl-cytosine (5mC) modification in a cohort of adults with HFA compared to sex- and age-matched NC.

  Study EGAS50000000508

• The gut microbiota in prediabetes and diabetes: a population-based cross-sectional study

  The link between the gut microbiota and type 2 diabetes (T2D) warrants further investigation because of known confounding effects from antidiabetic treatment. Here we profiled the gut microbiome in a discovery (n=1011) and validation (n=484) cohort comprising Swedish subjects naive for diabetes treatment and grouped by glycemic status.

  Study EGAS00001004480

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670