17482 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 39.65 milliseconds.

• SIGi001-A-10 / SAMEA4451117 WGS data

  The iPSC line SIGi001-A-10 / SAMEA4451117 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-10 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001074

• SIGi001-A-11 / SAMEA4451118 WGS data

  The iPSC line SIGi001-A-11 / SAMEA4451118 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-11 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001075

• SIGi001-A-12 / SAMEA104237570 WGS data

  The iPSC line SIGi001-A-12 / SAMEA104237570 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-12 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001076

• SIGi001-A-2 / SAMEA4451116 WGS data

  The iPSC line SIGi001-A-2 / SAMEA4451116 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001077

• SIGi001-A-6 / SAMEA4447426 WGS data

  The iPSC line SIGi001-A-6 / SAMEA4447426 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001078

• SIGi001-A-4 / SAMEA4448632 WGS data

  The iPSC line SIGi001-A-4 / SAMEA4448632 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001088

• SIGi001-A-5 / SAMEA4448708 WGS data

  The iPSC line SIGi001-A-5 / SAMEA4448708 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001092

• SIGi001-A-8 / SAMEA4448777 WGS data

  The iPSC line SIGi001-A-8 / SAMEA4448777 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001093

• SIGi001-A-9 / SAMEA4447499 WGS data

  The iPSC line SIGi001-A-9 / SAMEA4447499 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001095

• DAC for study "Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy"

  Dataset containing snRNA-seq samples from MSA or PD patients, and healthy controls. We aimed at identifying molecular processes at the single cell level that could identify common and/or disease-specific differences between healthy controls and patient groups. Frozen tissue samples from healthy controls, and multiple system atrophy or Parkinson's disease patients were excised and single nuclei were isolated following the 10x Genomics Chromium workflow.

  Dac EGAC50000000809

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• GELATO clinical trial whole exome sequencing data (primary tumors and local recurrences)

  Paired-end whole exome sequencing of 10 lobular breast cancer primary tumors, 3 local recurrences and matched normal samples obtained from 10 unique patients from the GELATO clinical trial. The included raw sequencing data in fastq format was generated using Illumina NovaSeq 6000 from archived FFPE material (tumor data) and fresh frozen material (matched normal data).

  Dataset EGAD00001009836

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• Single cell RNA sequencing of synovial B cells in early Rheumatoid Arthritis

  This dataset includes 3432 paired single cell sequencing fastq files derived from synovial B cells of 5 early Rheumatoid Arthritis patients. Libraries were prepared using the SmartSeq2 protocol. All wells contained ERCC spike-ins. Libraries were sequenced on an Illumina NovaSeq instrument with 2x100bp paired-end reads yielding a median of 2.5M reads/well. Sample aliases ending on 368 and 384 represent empty control wells. Sample aliases starting with P11417_4 and P13157_1 belong to ACPA- patient A7, sample aliases starting with P11417_5 and P11417_6 belong to ACPA+ patient A1, sample aliases starting with P13157_2 belong to ACPA- patient A3, sample aliases starting with P13157_3 and P13157_6 belong to ACPA+ patient A2, sample aliases starting with P13157_4 and P13157_5 belong to ACPA- patient A4.

  Dataset EGAD00001009076

• The Dutch Microbiome Project Batch 2

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 2 of DMP includes ~400 samples.

  Dataset EGAD00001007501

• Whole-genome sequencing of tumour, germline and plasma samples from a BRCA1-mutant breast cancer patient

  This data set contains the fastq files from whole-genome sequencing of temporally matched tumour (fresh frozen biopsies), blood germline and plasma samples collected from a BRCA1-mutant breast cancer patient to directly compare mutation signature analysis using gold-standard tumour-germline paired variant calling with a novel ctDNA-based method (MisMatchFinder).

  Dataset EGAD50000000811

• M116 CHIP Amplicon Sequencing

  Genomic DNA was obtained from M116 peripheral blood sample and was used for targeted deep sequencing (TDS) studies. Barcoded libraries were prepared according to the manufacturer’s instructions, using a probe-based panel (KAPA HyperCap, Roche®) targeting frequently mutated regions of 50 myeloid-related genes. Samples were run on a MiSeq (Illumina®) sequencer for paired-end 2x75 bp reads with a mean coverage of 1000X.

  Dataset EGAD50000001287

• SARS-CoV2 nasal epithelium

  Single cell RNA sequence generated from human primary nasal epithelium differentiated at air-liquid interface. This dataset comprises tissue from two donors, with cultures either unexposed or exposed to SARS-CoV2. Libraries were prepared using the 10X Genomics pipeline as per manufacturer's instructions.

  Dataset EGAD00001008159

• RNA Seq of 25 spheres derived from lymph nodes of lung cancer patients

  To further decipher the cell type composition within single spheres we performed RNA-Seq of 25 selected spheres of 4 different categories (including 8 signature-/balanced, 9 signature+/balanced, 1 signature-/aberrant, 7 signature+/aberrant). Samples were sequenced using Illumina NextSeq 2000.Fastq reads were processed using inhouse RNA-Seq workflow.

  Dataset EGAD00001011099

• SMARTer bulk RNA sequencing for highly purified CD271+ BMSCs from NBM and AML

  bulk RNAseq was conducted on highly purified CD45 - CD71 - CD235a - CD31 - CD271 + BMSCs isolated from a cohort of newly diagnosed 62 AML patients, uniformly treated within an intensive chemotherapy clinical trial and selected to represent the mutational landscape of AML

  Dataset EGAD00001011056

• Highly differentiated, fusion-negative rhabdomyosarcoma.

  Sequencing was performed using OncoPanel v.2 (OPv2), an Agilent SureSelect custom designed bait set consisting of the coding regions of 504 genes, previously linked to human cancer. Sequencing wa sperformed on an Illumina HiSeq 2500. 14 highly differentiated, fusion-negative rhabdomyosarcoma tumor samples, and 8 non-matched normal skeletal muscle samples weer sequenced. BAM files are available for download.

  Dataset EGAD00001003746

• (sn)RNA-seq dataset of Multi-modal analysis of pediatric pilocytic astrocytomas reveals tumor location-associated cellular and transcriptional heterogeneity

  Aim: to comprehensively characterize the cellular and transcriptional landscape of pediatric pilocytic astrocytomas across anatomical tumor locations

  Dataset EGAD00001015705

• Single-cell somatic copy number variants in brain using different amplification methods and reference genomes

  This dataset contains 224 paired fastq files (112 single cells) from the following samples: brains from two Multiple System Atrophy patients and one control, and non-brain controls (fibroblasts, NA12878)

  Dataset EGAD50000000030

• CHIC_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in glucose, lactate or with DCA. Samples were collected 7 hours after the treatments and processed for bulk CHIC-seq.

  Dataset EGAD50000000090

• MDS PacBio LRTS IsoSeq

  This dataset contains long read transcriptome sequencing of 25 myelodysplastic sndrome (MDS) patients with or without mutation in SF3B1. The BAM files are unaligned CCS reads.

  Dataset EGAD50000000077

• DKFZ-St.Jude Medulloblastoma - 6 TB control exomes

  6 control exomes, TB cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006664

• mRNA capture sequencing and RT-qPCR for the detection of pathognomonic, novel and secondary fusion transcripts in formalin-fixed paraffin-embedded tissue: a sarcoma showcase

  mRNA capture sequencing data (FASTQ files) of 28 FFPE sarcoma tumors

  Dataset EGAD00001007696

• Next Generation Sequencing in an IBD Pedigree Exome Data

  We perform whole exome sequencing on samples from a large IBD pedigree. The selected samples are from more distantly related family members (healthy and with IBD) and a set of matched population (Ashkenazy Jewish ancestry) samples.

  Dataset EGAD00001000422

• Ewing's Sarcoma Whole Genome Sequencing

  54 WGS Ewing's sarcoma samples sequenced at The Hospital for Sick Children Toronto (Adam Shlien's lab) and published on Science 2018. Reference Anderson et al. "Rearrangement bursts generate canonical gene fusions in bone and soft tissue tumors"

  Dataset EGAD00001004589

• RNA-seq

  Stranded RNA-seq libraries were performed for 150 ng of mRNA using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD00001010841

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451