17282 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 27.90 milliseconds.

• Sequence Data from the phase 2 PrE0505 trial of Durvalumab with First Line Platinum-Pemetrexed for Unresectable Pleural Mesothelioma

  Dataset comprises of 84 bam files from exome sequencing data, including 40 tumor-normal pairs and 4 normal files. Each sample is numbered by the patient case ID such as 135, 156 and so on. The filenames are suffixed with "_tumor" and "_normal" to indicate tumor and normal bam files respectively.

  Dataset EGAD00001008016

• RNA-seq of iPSC-derived oligodendrocytes of individuals with and without t(1;11) translocation

  This dataset contains high-throughput RNA-sequencing of 14 samples, each sample comprising oligodendrocytes derived from human induced pluripotent stem cells, from individuals with and without a balanced t(1;11) translocation which substantially increases risk of major mental illness. 5 samples derive from 2 control individuals, and 9 samples from 3 individuals carrying the translocation. Libraries were prepared from each total-RNA sample using the TruSeq Stranded Total RNA with Ribo-Zero kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 (150 cycle) Kit on the NextSeq 550 platform. Raw paired-end sequencing data is stored in two FASTQ files per sample.

  Dataset EGAD00001006341

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• McGill EMC Community projects Release 7 for cell line "hTERT RPE1"

  Complete reference epigenome (as defined by IHEC) of normal hTERT RPE1 cell line as well as hTERT RPE1 cell lines engineered to express EPC1-PHF1 and JAZF1-SUZ12 fusion proteins, found in Endometrial Stromal Sarcoma.

  Dataset EGAD00001007680

• Mutation and Microsatellite Burden Predict Response to PD-1 Inhibition in Children with Germline DNA Replication Repair Deficiency: An Observational Registry Study

  This dataset contains raw data from polyA RNAseq, hybrid capture target TCR panel data, and bam files from whole exome sequencing on 39 tumors with matched germline blood.

  Dataset EGAD00001008036

• FASTQ Data from In Situ Hi-C on Medulloblastoma Tissue Samples

  29 Hi-C datasets [8 G3 (MB3667, MB3687, MB3690, MB3692, MB3693, MB4010, MB4037, MB4141), 13 G4 (MB0558, MB3510, MB3670, MB3689, MB3716, MB3760, MB3761, MB3807, MB4079, MB4132, MB4174, MBSF7, SNC_2_5), 7 SHH (MB3612, MB3661, MB3662, MB3695, MB3697, MB3724, MB4143), and 1 WNT (MB4036)]. Fresh tissue samples were obtained from The Hospital for Sick Children (Toronto, ON). In situ Hi-C libraries were generated using approximately 2.5 million dissociated cells as input. All Hi-C libraries were sequenced at 150 bp PE with a Hi-Seq X instrument (Illumina) at McGill Genome Centre (Montreal, QC).

  Dataset EGAD50000000771

• 252 human breast cancer samples in WGS and WES

  We analyzed chromothripsis in 252 human breast cancers from two patient cohorts (149 metastatic breast cancers, 63 untreated primary tumors, 29 local relapses, 11 longitudinal pairs) using whole-genome and whole-exome (paired) sequencing. A lot of the WGS samples were sequenced on Illumina HiSeq X-Ten using Illumina TruSeq Nano DNA. For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000). For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000).

  Dataset EGAD00001007563

• TIGER samples

  The TIGER samples dataset contains PISA cohort samples which consist of paired RNA-seq and genotyping array data. It contains 127 RNA-seq pair-end samples in fastq format and 127 individuals genotypes in PLINK format.

  Dataset EGAD00001007990

• DDD_1 hypermutated individual

  CRAM files and VCF for DDD_1 and their parents. Also de novo mutations file for hypermutated DDD_1 child as described in the manuscript ‘Genetic and chemotherapeutic influences of germline hypermutation’ by Kaplanis et al. which will be published in Nature shortly.

  Dataset EGAD00001008497

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• Single-nucleus mRNA-Sequencing of prenatal and postnatal samples from the brain and its border regions

  Single-nucleus mRNA Sequencing of prenatal and postnatal samples from the brain and its border regions. Most samples were multiplexed with several samples run in one 10X reaction. A separate immune cell dataset was combined with published data from Braun et al 2023 and Yang et al 2021 integrated using harmony is included.

  Dataset EGAD50000000044

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• A first-in-human clinical study of an allogenic iPSC-derived corneal endothelial cell substitute transplantation for bullous keratopathy

  iPSC-derived corneal endothelial cell substitutes recover pathological corneal edema. No adverse reactions are observed after one year follow-up. Gene mutations may appear despite whole genome sequencing of the master cell bank. This study contains WGS data.

  Study EGAS50000000672

• Whole exome sequencing data for Molecular Characterization of ETMRs

  This dataset contains exome sequencing data from 21 samples. Sequencing of samples using whole-exome sequencing was per- formed by creating libraries using the IlluminaTruSeq exome enrich- ment kit following the manufacturer’s instructions after size selection. Size selection was performed by fractionation using a Covaris ultra- sonicator and subsequent selection was performed using a 1.5% gel Pippin Prep cassette (Sage Science). One lane per sample has been sequenced resulting in 42 Fastq files (paired end).

  Dataset EGAD00001006210

• The spatial organization of intratumor heterogeneity and evolutionary trajectories of metastasis in hepatocellular carcinoma

  A dataset consisting of Multi-regional Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) data for 54 samples from 9 patients with hepatocellular carcinoma. The dataset includes 45 tumor samples and 9 normal blood samples. Selected somatic variants were validated by Sequenom. Patients covered are: Patient 1, Patient 2, Patient 3, Patient 4, Patient 5, Patient 6, Patient 7, Patient 8, Patient 9 and Patient 10.

  Dataset EGAD00001003138

• Multiple myeloma follow-up Dataset

  77 samples collected from 35 multiple myeloma patients. Each patient provided one healthy sample and one primary tumor sample and, in some cases, also samples collected after the progression of the disease.

  Dataset EGAD00001010161

• Longitudinal Transcriptomic Profiling of Endothelial Progenitor Cells in Post-COVID-19 Patients: Insights at 3 and 6-Months Post-SARS-CoV-2 Infection

  Raw transcriptomic data from endothelial cells of post-COVID patients and healthy controls. Samples were collected from post-COVID patients at 3 months (n = 6) and 6 months (n = 6) post-infection, as well as from healthy control individuals (n = 5). All post-COVID patients were hospitalized during the first wave of the pandemic. Among them, half developed pulmonary embolism (TEP; n = 6), while the other half did not (no TEP; n = 6).

  Dataset EGAD50000001452

• 10X single cell RNA- and feature barcode sequencing of 38 AML samples

  This dataset contains fastq-files from single cell 3' RNA- and feature barcode sequencing of AML samples using 10X technology (Chromium Single Cell 3ʹ Reagent Kit v3). In total, the dataset contains data from 38 AML samples from either bone marrow or peripheral blood, representing the following genetic subtypes: NPM1-mutated, myelodysplasia related, TP53-mutated, CBFB::MYH11, RUNX1::RUNX1T1, AML without class-defining mutations, and AML meeting criteria of two subtypes. The data consists of sequenced gene expression libraries from 38 samples and feature barcoding libraries covering a panel of 10-14 surface proteins for 34 samples.

  Dataset EGAD50000001577

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines

  Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project were selected for ribosomal profiling. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dac EGAC50000000209

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• EM-seq data from plasma cfDNA samples of ALS patients, control and C9-carriers

  This dataset contains targeted EM-seq data from 61 plasma cfDNA samples spanning 20 sporadic ALS, 10 C9orf72-ALS, 10 asymptomatic C9orf72 expansion carriers, and 21 non-disease controls. Libraries were prepared with the NEBNext Enzymatic Methyl-seq (EM-seq) kit, captured using the Twist Human Methylome Panel (3.98 M CpGs; 123 Mb), and sequenced on Illumina NovaSeq 6000 (150 bp paired-end; ~45× on-target depth) with unmethylated lambda DNA spike-in and a 20% PhiX balance library. The dataset includes per-sample gzipped FASTQ files (R1/R2) and minimal metadata.

  Dataset EGAD50000001808

• Whole Genome Sequences of 18th century African descended individuals from Charleston, South Carolina.

  This study presents Whole Genome Sequencing results from the Anson Street African Burial Ground Project, which is a community-based initiative aimed at understanding the histories of 37 Ancestors in Charleston, South Carolina. Here we report fastq files for all 37 Ancestors. DNA was extracted at the University of Tennessee-Knoxville following Dabney et al. 2013, and dual index libraries prepared using a modified NEBNext Ultra II kit with partial USER enzyme digestion. Libraries were then enriched for human genomic DNA (MyBaits) and sequenced on Illumina Platforms.

  Dataset EGAD00001009643

• Blood plasma and FFPE derived total RNA seq dataset from DLBCL and PMBCL patients

  Blood plasma samples (n=168) and matched diagnostic formalin-fixed paraffin-embedded (FFPE) tissue samples (n=69) of DLBCL patients, PMBCL patients and healthy controls were collected between 2016-2021. Plasma samples were collected at diagnosis, at interim evaluation, after treatment, and in case of refractory or relapsed disease. RNA was extracted from 200 µl plasma using the miRNeasy serum/plasma kit and from FFPE tissue using the miRNeasy FFPE kit. RNA was subsequently sequenced on a NovaSeq 6000 instrument using the SMARTer Stranded Total RNA-seq pico v3 library preparation kit.

  Dataset EGAD00001011679

• ProstOmics - Spatial Transcriptomics

  Spatial transcriptomics data (ST) from 32 human prostate tissue samples originating from 8 prostate cancer patients (5 patients with post-surgery relapse). The ST data was acquired using the Visium Spatial Gene Expression kit which resulted in over 20 000 spatially defined spots for the 32 tissue samples. The raw transcriptomics data is RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Each ST spot has metadata such as sample origin, histology class (stroma, normal epithelium, cancer of various grading etc), number of cells and estimated cell type fractions. Patient metadata include information of age at surgery, time (months) until reported relapse, total follow-up time, pre-surgery PSA, post-surgery T-stage and metastasis status.

  Dataset EGAD50000000603

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• Dataset for hepatopancreaticobiliary_malignancy-RNA

  Rare cancer sequencing data of 119 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008863

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: SAFER-COVID - Integration of Testing and Digital Health

  SAFER-COVID provides a set of self-management tools to consumers to track symptoms, test results, vaccine record, and environmental factors, such as exposure to others. Consumers may choose to integrate data from wearables and electronic health records (EHR) for self management. These data are used to enable multiple use cases such as return-to-work, activity risk assessment and self-management within SAFER-COVID.DOI: https://rapids.ll.mit.edu/10.57895/cmt5-gh78

  Study phs002540

• Oncogenic FOXL2C134W has gain-of-function chromatin remodeling activity that reprograms glucocorticoid receptor occupancy to promote ovarian granulosa cell tumor growth

  This dataset contains bam files from the whole exome sequencing performed on granulosa cell tumors and 7 sequencing experiments performed on human-derived KGN granulosa cell tumor cells and isogenic cell lines. The latter include transcription factor ChIP-seq for Foxl2 as well as transcription factor ChIP-seq for Foxl2 and GR under dexamethasone treatment and untreated conditions, two ATAC-seq data sets, two RNA-seq data sets, and Histone marks ChIP-seq.

  Dataset EGAD50000000880

• Mutational analysis of an oligoprogressive sarcomatoid hepatocellular carcinoma treated with an immune checkpoint inhibitor.

  The dataset is composed of three sequenced tumor samples: (I) Meta-bone-557 (bone metastasis obtained from occipital lesion resection during treatment with Liposomal doxorubicin); (II) Meta-CNS-888 (brain metastasis obtained from surgical resection during treatment with Nivolumab); (III) Primary-liver-463 (primary hepatic tumor obtained from surgical resection during treatment with Nivolumab). Genomic DNA from tumor samples was extracted using GeneRead DNA FFPE kit (Qiagen), containing Uracyl-D Glycosylase, according to the manufacturer’s instructions. Whole-exome libraries were prepared using SureSelect XT Clinical Research Exome Target Enrichment kit (Agilent Technologies # 5190-7338). Sequences (150bp paired-end) were generated on a NextSeq 500 sequencing platform (Illumina).

  Dataset EGAD00001006982

• Targeted Sequencing of 173 genes

  Targeted sequencing of 173 genes in 2433 primary breast tumours. Data includes 2433 tumour samples, 523 adjacent normal (breast) samples and 127 blood samples. Libraries were prepared with Illumina's Nextera custom enrichment kit targetting all the exons of the most frequently mutated breast cancer genes. Libraries were multiplexed (48 libraries per lane) and sequenced on Illumina HiSeq 2000 (100bp paired-end reads). Somatic mutations were calling with a custom pipeline. We identified 40 mutation-driver (Mut-driver) genes, and determined associations between mutations, driver CNA profiles, clinical-pathological parameters and survival. We assessed the clonal states of Mut-driver mutations, and estimated levels of intra-tumour heterogeneity using mutant-allele fractions. The results emphasize the importance of genome-based stratification of breast cancer, and have important implications for designing therapeutic strategies. Referece: Pereira et al. (2016) The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nature Communications

  Dataset EGAD00001002115

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma samples (99 FFPE tumor tissue derived DNA and 9 circulating tumor DNA) and corresponding germline DNA of 38 controls. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dac EGAC50000000261

• Transcriptomic sequences of small intestinal Plasma cells from Celiac disease patients

  Transcriptomic sequences of small intestinal Plasma cell (PCs)s from Celiac disease patients. RNAseq data produced using Illumina paired-end (75bp) reads. Includes only raw data of sequences (fastq format). Samples from seven Celiac disease patients and four healthy controls. Samples from Celiac disease patients contain sub-groups of PCs that are either specific or not specific to autoantigen of the disease (TG2).

  Dataset EGAD00001004481

• Next generation sequencing data of circulating tumor DNA and matched tumor tissues

  For each subject, genomic DNA from whole blood, circulating cell free DNA and tumor tissues (whenever possible) were performed targeting next generation sequencing on Illumina Miseq or Hiseq 4000 platforms. The sequencing results of whole blood were used to distinguish germline and somatic mutations. Specimens were collected from patients with different kinds of solid tumors, but most are lung cancer patients.

  Dataset EGAD00001003176