4955 results for "*oma"

in 23.16 milliseconds.

• Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant

  Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant. The Panel was designed using Agilent SureDesign on SureSelect XTHS Hybrid Capture Panel. Sequencing was done on Illumina NovaSeq 6000

  Dataset EGAD50000001548

• WGS Sequencing of Urothelial Carcinoma from Taiwan

  Normal and Tumor paired WGS sequencing of UC Tissues

  Dataset EGAD50000001547

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• Clinical Outcomes for 344 Diffuse Large B-Cell Lymphoma Patients

  This dataset contains clinical outcomes for 344 Diffuse Large B-Cell Lymphoma patients. For each subject we have recorded AGE (binarized: > 60, <= 60), SEX (male or female), LDH (serum lactate dehydrogenase), ECOG (Performance status 3 or 4), STAGE (Disease stage III or IV according to the Ann Arbor staging system), EXBM (Two or more extranodal sites of disease (outside of a lymph node), BSYMP (Presence of B symptoms), and BM (Bone marrow involvement). All data are delivered as a single XLSX file with one row per patient.

  Dataset EGAD50000001536

• Visium CytAssist Spatial Gene Expression analysis for glioblastoma

  The glioblastoma spatial transcriptomics dataset was generated from 4 FFPE fixed adult glioblastoma samples, using the 10x Genomics Visium platform, producing raw FASTQ files, spatial feature matrices (.h5, .mtx, .tsv), and paired histology images (.tif). Spot-level transcript counts were aligned to tissue architecture and processed in Seurat, with results stored as .rds objects. Data visualization was performed using SpatialFeaturePlot, and quantitative analyses were supported by custom Matlab scripts. The dataset provides both raw and processed files, offering reproducible spatially resolved transcriptomic profiles of glioblastoma tissue sections

  Dataset EGAD50000001767

• SIA Subtyping RNA Sequencing

  Associated with Molecular classification of small intestinal adenocarcinomas. RNA sequencing generated 849 .fastq files from 137 primary and recurrent small intestine adenocarcinoma samples from 135 patients.

  Dataset EGAD50000001762

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing (part 2)

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38). This dataset contains the remaining file of this study.

  Dataset EGAD50000001757

• Targeted panel sequencing of two patient-derived melanoma cell lines

  Targeted panel sequencing was conducted on patient-derived cell lines: Mel-DCC-11 (the parental line, sensitive to the BRAF inhibitor) and Mel-DCC-11-R (resistant to the BRAF inhibitor). The parental cell line was generated from disseminated cancer cells (DCCs) obtained from a lymph node sample of a melanoma patient. The resistant cell line was generated from the parental one through exposure to Vemurafenib. Normal peripheral blood lymphocytes from the same patient served as the control for comparison. Sequencing on NovaSeq6000. Fastq files.

  Dataset EGAD50000001745

• Patient-derived organoids cohort raw FASTQ from SGMedical

  Raw FASTQ files for a glioblastoma multiforme organoid study, including exome sequencing and RNA-seq. 29 runs (paired-end), 58 FASTQ.c4gh files (R1/R2). Short-read Illumina; library strategies include exome capture and stranded total RNA-seq (see Experiment records for kit/instrument details). No processed results are included; access is controlled under the selected Policy.

  Dataset EGAD50000001741

• Shallow Whole Genome Sequencing (sWGS) of pancreatic ductal adenocarcinoma

  Associated with CNA differences between RNA-based subtypes of PDAC. Shallow Whole Genome Sequencing (sWGS) generated 47 .bam files from 37 patients. sWGS was used for Copy number aberrations (CNA) determination.

  Dataset EGAD50000001732

• WES dataset of a TIL-ACT metastatic melanoma cohort

  Whole-exome sequencing (WES) data from 13 patients with metastatic melanoma in a TIL-ACT cohort, generated to characterize tumor genomics and neoantigen landscapes relevant to adoptive T cell therapy.

  Dataset EGAD50000001731

• Five Mantle Cell Lymphoma Patients Before and After Failure of Standard Chemotherapy

  MCL cells were isolated from different tissues of five patients with MCL at diagnosis, and at the time of the first clinical relapse after failure of standard immunochemotherapy based on alternation of R(ituximab)-CHOP and R-high-dose-araC. All patients signed informed consent according to the Declaration of Helsinki. Four patients were diagnosed with classical nodal aggressive MCL, and all these patients experienced early relapse (i.e., progression of disease POD < 12 months). One patient was diagnosed with indolent non-nodal MCL and relapsed 9 years after initial MCL diagnosis. The dataset presents single cell RNA sequencing data as well as whole exome sequencing data for these five patients.

  Dataset EGAD50000001213

• Exome-sequencing on early oral squamous cell carcinoma with clear margins

  Whole exome sequencing (WES) on early oral squamous cell carcinoma (OSCC) with clear margins, and on resection margins, 86 patients with a median follow-up of 58 months (range 30.4-83 months). Raw data (fastq format).

  Dataset EGAD50000001209

• Single-cell RNA-sequencing on malignant and benign tissue samples

  Single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis was performed in order to deduce tissue adaptive expression patterns of the disease. Matching tissue from five donors with untreated CRC and liver metastasis were sampled.

  Dataset EGAD50000001203

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• Shallow dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. shallow Whole Genome Sequencing (sWGS) of 63 samples. sWGS was done to analyze copy number aberration.

  Dataset EGAD50000001165

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Refractory Classic Hodgkins Lymphoma (cHL) sWGS

  Associated with the study: Blood-based Monitoring of Relapsed/Refractory Hodgkin Lymphoma Patients Predict Responses to Anti-PD-1 Treatment. 26 ctDNA Samples from 4 patients followed longitudinally. sWGS performed for copy number aberration (CNA) analysis.

  Dataset EGAD50000001163

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• mUM patient biopsies bulk RNAseq

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system

  Dataset EGAD50000001225

• Bulk RNA-sequencing data of advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab.

  The dataset includes FASTq files and normalised gene expression counts from bulk RNA-sequencing of pre-treatment tumour (n=39) and adjacent non-tumour tissue samples (n=13) from advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab. Specifically, RNA was extracted from the FFPE tumour tissue using RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions. RNA quality and quantity were evaluated using Agilent RNA 600 Pico Chips (Agilent Technologies). Sequencing libraries were prepared using the SMARTer Stranded Total RNA-seq kit v3 (Takara Bio). Sequencing was performed on an Illumina NovaSeq 6000 system. After obtaining the Fastq files, read 2 UMIs and adapters were trimmed using seqtk (v1.2), reads were aligned using STAR (v2.7.7a) to the human reference genome (GRCh38) and quantified with HTSeq (v2.0.2).

  Dataset EGAD50000001227