19477 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 54.09 milliseconds.

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX006_PBC04106_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 3 samples; filetype=fastq

  Dataset EGAD00001005163

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX006_PBC04106_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 3 samples; filetype=fastq

  Dataset EGAD00001005164

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX038_VOA11267_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 3 samples; filetype=fastq

  Dataset EGAD00001005165

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX050_PBC04573_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005166

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX050_PBC04573_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005167

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX051_PBC04633_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005168

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX051_PBC04633_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005169

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX055_VOA11924A_37C

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005170

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX056_VOA11924F_37C

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005171

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX054_SA604X9XB02417_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005172

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX054_SA604X9XB02417_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005173

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX057_SA535X5XB02887_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005174

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX057_SA535X5XB02887_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005175

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX049_SA928_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005176

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX049_SA928_002

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005177

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX049_SA928_003

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005178

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX067_VOA12024_001

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005179

• Sequencing data for study Dissociation of solid tumour tissues with cold active protease for single-cell RNA-seq minimizes conserved collagenase-associated stress responses for library TENX067_VOA12024_003

  Single-cell RNA-sequencing data generated using the 10X genomics chromium platform, comprising patient derived xenograft, cell line, and primary tumour data. This includes different digestion conditions (37C collagenase vs 6C cold protease) and FACS sorting for live, dying, and dead cells. 12 samples; filetype=fastq

  Dataset EGAD00001005180

• Genomics of Malignant Peripheral Nerve Sheath Tumor (MPNST)

  The Genomics of MPNST (GeM) Consortium dataset includes de-identified whole genome sequencing data (.bam) for germline samples (DNA primarily derived from blood) sequenced at standard (30x) coverage (n=88) and for tumor samples (DNA derived from fresh frozen tissue) sequenced at 90x coverage (n=105). This dataset also includes transcriptome profiling data (.fastq) for paired normal nerve samples (n=7) and for tumor samples (n=132).

  Dataset EGAD00001008608

• Transcriptomic data of a discordant monozygotic twin pair for ALS

  The dataset contains bulk RNAseq data of a discordant monozygotic twin pair for ALS; in particular the matrix with gene names and TPM counts for each sample. For both healthy and ALS twin, RNA sequencing was performed on RNA samples collected at two different time points (T1 and T2), for a total of seven samples. RNA extracted from PBMCs was used for library preparation according to Illumina TruSeq Stranded mRNA kit and processed on Illumina NextSeq 550 sequencer. Reads were aligned to the reference human genome GRCh38/hg38 and annotations were provided by the Ensembl v100 database.

  Dataset EGAD50000001330

• Spatial transcriptomics

  This dataset contains raw sequencing and processed data of spatially resolved transcriptomes. The data were generated with 10x Visium probe-based assay on FFPE tissues of 30 ST-EPN tumour resections. Raw data contain two-lane fastq files of the sequencing. Processed data contain aligned and filtered .h5 counts matrices as well as positional files as generated by 10x SpaceRanger.

  Dataset EGAD50000001876

• Raw sequencing data from low-input chromosome conformation capture in CD4+ T cells

  This dataset contains raw sequencing data from low-input PCHi-C in human primary CD4+ T cells isolated from healthy donors. The data are released as paired-end Illumina FASTQ files. Promoter Capture Hi-C used DpnII digestion and Tn5-based low-input library preparation, followed by targeted capture with custom-designed biotinylated RNA probes targeting most of the annotated gene promoters.

  Dataset EGAD50000001873

• Whole exome sequence of human XXY fibroblasts

  This dataset contains Whole exome sequence generated using human skin fibroblast sample (ID 419281) from Klinefelter XXY syndrome patient fibroblasts. These fibroblasts were used to generate autosomally isogenic human iPSCs. The sample DNA was collected using commercial kit and Human All Exon v5 capture paired library was sequenced using Illumina HiSeq device. The fastq file (ID 493224) and analysis (ID 3209) bam files have been deposited.

  Dataset EGAD50000001362

• Single-cell RNA and TCR sequencing of CSF cells and PBMCs from individuals with neurological disorders

  We performed single-cell RNA sequencing combined with T-cell receptor sequencing to characterize immune cells from cerebrospinal fluid (CSF) and peripheral blood mononuclear cells (PBMCs) of patients with multiple sclerosis and individuals with other inflammatory neurological diseases used as controls. The aim of this study was to identify and characterize T cells with TCRs shared among people with MS and enriched in the CSF compartment.

  Dac EGAC50000001015

• RNA-seq dataset of lung adenocarcinomas

  This dataset includes the RNA-seq data from a study entitled "Tracing Oncogene Rearrangements in the Mutational History of Lung Adenocarcinoma". PolyA tails were captured by Oligo-dT beads, and sequencing run was made in HiSeq 2500 machines. Paired-end FASTQ files are provided in our dataset.

  Dataset EGAD00001004794

• Gene expression adaptation of metastases to their host tissue

  The adaptation of metastatic cells to their host tissue critically determines the pathogenicity of a cancer and therefore patient survival. Yet, it remains elusive to what extent the host environment drives gene expression programs in metastatic cells. Here we identify adaptive mechanisms that enable metastases to establish themselves in a novel tissue context. We performed single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis to deduce tissue adaptive expression patterns. A novel computational approach identified genes and pathways that consistently adapted to the host tissue at the transition from the primary tumor to the paired metastasis across donors. This analysis revealed that the majority of expression changes in the metastasis reflect an expression signature reminiscent of benign liver epithelial cells. Cellular processes adapting to the liver environment include basic cellular functions such as energy metabolism, as well as tissue-specific pathways such as the regulation of lipid metabolism by PPAR-α. These adaptations potentially increase the pathogenicity of the metastatic cells and may provide new therapeutic strategies.

  Study EGAS50000000817

• Single-cell gene expression data from CD8+ T cells from two Austrian COVID19 patients stimulated with wildtype and mutant SARS-Cov-2 peptides

  The data contains single-cell gene sequencing data (10x Genomics) from FACS-purified CD8 T lymphocytes from two Austrian patients. The cells were stimulated with one MHC class I peptides obtained from a common (wild type) variant and an emerging mutant variant of the SARS-Cov-2 virus. Then the samples were multiplexed using hashtag oligos. We provide the raw and aligned sequence data for: i. The single-cell experiments ii. The PCR-amplified samples for enrichment of the hashtag oligo multiplexing barcodes iii. The PCR-amplified samples for enrichment of the T Cell Receptor (TCR) VDJ region for immuno-profiling. The samples and libraries were processed and obtained in collaboration between St. Anna Children's Cancer Research Institute (CCRI), CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, and the Medical University of Vienna. The cell barcodes and processed data has been submitted to the GEO database with GEO accession GSE166651.

  Dataset EGAD00001006995

• Two lung cancer cell lines with EGFR mutations, PC-9 and KHM-3S, were either treated with Tarceva for 24 hours or left untreated. The gene expression profiles were examined by RNAseq, and the genome wide binding profiles of total STAT3 and pSTAT3 were characterized by ChIPseq.

  Lung cancers harboring activating EGFR mutants show dramatic responses to EGFR TKIs, such as Tarceva. However, nearly all patients show relapse within 1 year after initial treatment. To investigate the early signaling switches that are involved in the formation of drug resistance, and the role of STAT3 in the early signaling switches involved in the formation of drug resistance, we have treated two lung cancer cell lines with EGFR mutations, PC-9 and KMH-3S, with Tarceva for 24hours. The RNA samples with and without treatment were collected in triplicate for RNAseq experiment.The total STAT3 and pSTAT3 chromatinIP were done on samples with and without treatment for ChIPseq.

  Study EGAS00001000793

• Genome-wide quantification of rare somatic mutations in normal human tissues using massively parallel sequencing

  We present Bottleneck Sequencing System (BotSeqS), a nextgeneration sequencing method that simultaneously quantifies rare somatic point mutations across the mitochondrial and nuclear genomes. BotSeqS combines molecular barcoding with a simple dilution step immediately prior to library amplification. We use BotSeqS to show age and tissue-dependent accumulations of rare mutations and demonstrate that somatic mutational burden in normal tissues can vary by several orders of magnitude, depending on biologic and environmental factors. We further show major differences between the mutational patterns of the mitochondrial and nuclear genomes in normal tissues. Lastly, the mutation spectra of normal tissues were different from each other, but similar to those of the cancers that arose in them. This technology can provide insights into the number and nature of genetic alterations in normal tissues and can be used to address a variety of fundamental questions about the genomes of diseased tissues.

  Study EGAS00001001838

• Single nuclei ATAC-Seq data from the human ganglionic eminences

  We performed the single nuclei Assay for Transposase-Accessible Chromatin with Sequencing (snATAC-Seq) to map potential regulatory genomic regions operating in individual cell populations of the human GE, using these to test for enrichment of schizophrenia common genetic variant liability and to functionally annotate non-coding variants associated with the disorder.

  Study EGAS50000000411

• The_Causes_of_Clonal_Blood_Cell_Disorders_Study___SCOR_Custom

  We took a bone marrow aspirate and peripheral blood samples from a healthy patient aged around 60, and use flow cytometry to isolate 100 HSCs, 50 MEPs, and 50 GMPs. We grew these up into colonies, then whole genome sequenced each colony. Somatic mutations act as a unique barcode for each clone. We have designed a panel for targeted resequencing of the mutations that we find. We are now looking for these mutations in the peripheral blood, to see the dynamics of how HSCs contribute to the peripheral blood in health.

  Study EGAS00001002257

• Genomic landscape of signals of positive natural selection in North Eurasia

  We searched for the genomic signatures of positive selection in the genome-wide data of 432 people from eight different northern Russian populations (Russians from the Archangelsky and Vologdsky regions, Izhemski Komi, Priluzski Komi, Veps, Khanty, Mansi and Nenets) who were genotyped using microarrays for 700,000 SNPs (InfiniumOmniExpress-24v1-2_A1) through testing the extended haplotype homozigosity (EHH).

  Study EGAS00001003955

• DNA methylation of peripheral blood leukocytes from patients with Li-Fraumeni syndrome

  Genomic DNA (~ 1 μg) from LFS patients was treated using sodium bisulfite (Qiagen) converting unmethylated cytosine to uracil but leaving methylated cytosine intact. These samples were then hybridized to the HumanMethylation450 BeadChip or HumanMethylationEPIC BeadChip from Illumina at the Centre for Applied Genomics (TCAG) at the Hospital for Sick Children using the manufacturer’s recommended protocol.

  Study EGAS00001007075

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Study EGAS50000001051

• miRNA seq

  miRNA Sequencing of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Study EGAS50000001050

• Insights from genome-wide data from Thailand and Laos

  We provide the first detailed insights into the genetic profiles of Thai/Lao ethnolinguistic groups, which should be helpful for reconstructing human genetic history in MSEA and selecting populations for participation in ongoing whole genome sequence and biomedical studies

  Study EGAS00001006053

• The dataset for Single molecule genome-wide mutation profiles of cell-free DNA for non-invasive detection of cancer

  The dataset for Single molecule genome-wide mutation profiles of cell-free DNA for non-invasive detection of cancer includes 57 BAM files from whole genome next-generation sequencing on the Illumina HiSeq2500. The samples analyzed include plasma samples from individuals with and without cancer.

  Dataset EGAD00001010891

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• Metastatic_breast_cancer_targeted_gene_screen

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations.

  Study EGAS00001000704

• Aggregated panel-seq VCF for initial cohort screened for BoB

  Aggregated VCF file from cancer genes panel seq for the initial (n=500) cohort of solid tumors screened for the Basket of Baskets study

  Dataset EGAD00001008437

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Dataset with WGBS data of CRC and colon tissue

  This dataset contains WGBS data from 20 samples, which are either from colorectal cancer or control colon tissue. Sequencing was performed on either Illumina HiSeq 2000 or HiSeq X and the sequences are paired.

  Dataset EGAD50000000772

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Plasma cell-free whole genome sequencing

  This dataset contains whole genome sequencing data generated from plasma cell-free DNA of metastatic breast cancer patients and healthy individuals. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002524

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993