19278 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 34.39 milliseconds.

• ATAC-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for 3-4 months, then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-)

  Study EGAS00001006511

• The dataset for "Validation of cfDNA fragmentome analyses for early detection of liver cancer"

  The dataset for “Validation of cfDNA fragmentome analyses for early detection of liver cancer” includes 380 cram files from whole genome next-generation sequencing on the Illumina NovaSeq 6000 with 10x coverage. The samples analyzed include plasma samples from patients with cancer and liver disease.

  Dataset EGAD00001015538

• Convergent somatic mutations in effectors of insulin signalling in chronic liver disease

  Chronic liver disease is associated with metabolic dysregulation, liver failure and hepatocellular carcinoma. We analysed somatic mutations from 1202 genomes across 32 liver samples, including normal controls, alcohol-related and non-alcoholic fatty liver disease. Five of 27 patients with liver disease carried hotspot driver mutations in FOXO1, the major transcription factor downstream of insulin signalling. FOXO1 mutations were independently acquired by up to 5 distinct clones within the same patient’s sample, and impaired insulin-mediated nuclear export of FOXO1. GPAM, which produces storage triacylglycerol from dietary calories, also had significant excess of mutations, similarly exhibiting convergent evolution within biopsies. Telomeres were shorter in diseased than normal liver, with attrition more pronounced in larger clones. Multiple independent acquisitions of drivers within one small liver sample imply that such mutations could affect hundreds of grams of tissue across the whole organ, potentially contributing to systemic metabolic dysfunction.

  Dataset EGAD00001006255

• Next Generation Sequencing platform for targeted Personalized Therapy of Leukemia - Acute myeloid leukemia

  The advent of high-throughput next generation sequencing (NGS) technologies that are revolutionizing genomics and transcriptomics by providing a single base resolution tool for a unified deep analysis of diseases complexity allows a fast and cost-efficient fine-scale assessment of the genetic variability hidden within cohorts of patients affected by the same leukemia. That being so, by potentially highlighting inter-individual differences that may play a role in the differential success of diverse therapeutic interventions, they promise to be crucial for selecting the most appropriate medical treatments. The project aims at the identification of novel prognostic biomarkers for acute myeloid leukemia (AML) and studied the molecular differences between aneuploid and euploid AML.

  Study EGAS00001005464

• Genotype variables of the 61 COVID-19 patient cohort used in the main project of data integration

  We selected SNPs with a minor allele frequency (MAF) higher than 10% in the Caucasian population from the Ensembl database. Specifically, we selected ACE2 (rs2285666), MX1 (rs469390), and TMPRSS2 (rs2070788) for the present analysis. For more information, please refer to:

  Study EGAS50000000589

• Collaborative Cohort of Cohorts for COVID-19 Research (C4R): Atherosclerosis Risk in Communities Study (ARIC)

  Cohort Description The Atherosclerosis Risk in Communities (ARIC) study began in the mid-1980s with the initial aims being to describe the presence of subclinical atherosclerosis, the progression of atherosclerosis to clinical cardiovascular disease (CVD), and the association of novel risk factors with CVD. ARIC recruited its cohort of men and women aged 45-64 in 1987-89 from four communities (Forsyth County, NC; Jackson, MS; suburban Minneapolis, MN; and Washington County, MD). As of 2025, ARIC counts over 4,000 participants.Data Submitted Wave 1 questionnaire data includes 356 variables for up to 5763 ARIC participants in C4R. Wave 2 questionnaire data includes 367 variables for up to 5000 ARIC participants in C4R. Wave 3 questionnaire data includes 81 variables for up to 3450 participants in C4R.Dried Blood Spot/Serosurvey data includes 8 variables for up to 2437 ARIC participants in C4R. Derived data includes 62 variables for up to 18765 observations. Phenotype data includes 163 variables for up to 5937 ARIC participants in C4R. Brain MRI data includes 13 variables for up to 2550 participants in C4R.HCU data includes 21 variable for up to 631 ARIC participants in C4R.Lung CT data includes 15 variables for 1329 ARIC participants in C4R.Neurocognitive data includes 16 variables and 49826 observations.Serosurvey data includes 20 variables for 1707 ARIC participants in C4R.

  Study phs002988

• Clinical activity and molecular correlates of response to atezolizumab alone or in combination with bevacizumab versus sunitinib in renal cell carcinoma

  We examined pre-treatment tumors from participants of the IMmotion150 trial. Biomarker analyses indicate that high angiogenesis gene expression was associated with improved PFS within the sunitinib arm, and high T-effector/IFNγ response (Teff) gene expression with longer PFS in atezolizumab + bevacizumab vs sunitinib patients. In high Teff tumors, concomitant high myeloid inflammation was associated with worse PFS in the atezolizumab monotherapy arm; adding bevacizumab to atezolizumab in this subgroup improved PFS vs atezolizumab. Molecular profiles suggest that prediction of outcomes with VEGF inhibitors and immunotherapy may be possible in mRCC, and bevacizumab may overcome myeloid inflammation-associated atezolizumab resistance.

  Study EGAS00001002928

• Synchronous patterning of hiPSC-derived CNS progenitors generates comprehensive axial spinal cord organoids (CASCOs) containing diverse motor neuron population

  Advancements in human induced pluripotent stem cell (hiPSC) culture have enabled the generation of spinal cord organoids (SCOs), though achieving distinct axial identities in spinal motor neurons (spMNs) along the rostro-caudal (RC) axis remains a challenge. By optimizing the timing and sequence of patterning factors, we developed a mixed stem cell model of rostral neural stem cells (NSCs) and caudal neuromesodermal progenitors (NMPs) to generate SCOs with enhanced spMN heterogeneity, including a wide range of axial identities and benchmarked this against commonly used protocols. Our approach, termed CASO (Comprehensive Axial Spinal Organoids), also incorporates endothelial networks and skeletal muscle to improve organoid complexity and health, offering a novel method to study spMN axial specification and model neurodegenerative diseases.

  Study EGAS50000000891

• SNP arrays for chemotherapy response project

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). Illumina SNP arrays (760k markers) were performed using DNA from 49 tumors and associated germline DNA (49x median coverage). Data provided here consist of 98 files.

  Study EGAS00001004519

• Unraveling the heterogeneity of multiple myeloma identifies therapy resistant subpopulation with vulnerability to the splicing pathway intervention

  Intra-tumor heterogeneity underlies the therapy resistance of multiple myeloma (MM). However, its details remain unknown. Here, we performed single-cell RNA sequencing coupled with VDJ targeted sequencing on highly purified bone marrow lineage marker-negative CD38+ MM cells from patients at diagnosis and in remission. This approach successfully subdivided MM cells into distinct clusters, unraveling their heterogeneity and plasticity on the axis of cell surface CD138 expression. Notably, unique clusters were identified in the minor CD138-negative population that resisted therapies. CRISPR/Cas9 screening of upregulated genes in the resistant population identified their vulnerability to the splicing pathway inhibition, among which RNA-binding protein 39 (RBM39) appeared to be overexpressed in the resistant population and involved in aberrant splicing. Genetic and pharmacological inhibition of RBM39 exerted a profound synthetic lethal effect on them. Our results unveil an uncharacterized subpopulation associated with therapy resistance and provide a novel therapeutic strategy targeting the splicing pathway in MM.

  Study JGAS000723

• Multiome_HB

  Hepatoblastoma (HB) cells display strong phenotypic heterogeneity with a major impact on drug response, but the underlying mechanisms are poorly understood. Here, we use a single-cell multi-omic strategy to unravel the molecular determinants of this plasticity. HB display a continuum of single-cell states between hepatocytic (scH), liver progenitor (scLP) and mesenchymal (scM) differentiation poles, with an intermediate scH/LP population bordering scLP and scH areas in spatial transcriptomics. Chromatin accessibility landscapes reveal the gene regulatory networks of each differentiation pole, and the sequence of transcription factor activation underlying cell state transitions. Single-cell mapping of somatic alterations reveals the clonal architecture of each tumor, showing that each genetic subclone displays its own range of cellular plasticity across differentiation poles. The most scLP subclones, overexpressing stem cell and DNA repair genes, proliferate faster after neo-adjuvant chemotherapy. These results highlight how the interplay of clonal evolution and epigenetic plasticity shapes the potential of HB subclones to respond to chemotherapy.

  Study EGAS00001006932

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Spatial transcriptomics

  This dataset contains raw sequencing and processed data of spatially resolved transcriptomes. The data were generated with 10x Visium probe-based assay on FFPE tissues of 30 ST-EPN tumour resections. Raw data contain two-lane fastq files of the sequencing. Processed data contain aligned and filtered .h5 counts matrices as well as positional files as generated by 10x SpaceRanger.

  Dataset EGAD50000001876

• Raw sequencing data from low-input chromosome conformation capture in CD4+ T cells

  This dataset contains raw sequencing data from low-input PCHi-C in human primary CD4+ T cells isolated from healthy donors. The data are released as paired-end Illumina FASTQ files. Promoter Capture Hi-C used DpnII digestion and Tn5-based low-input library preparation, followed by targeted capture with custom-designed biotinylated RNA probes targeting most of the annotated gene promoters.

  Dataset EGAD50000001873

• Whole exome sequence of human XXY fibroblasts

  This dataset contains Whole exome sequence generated using human skin fibroblast sample (ID 419281) from Klinefelter XXY syndrome patient fibroblasts. These fibroblasts were used to generate autosomally isogenic human iPSCs. The sample DNA was collected using commercial kit and Human All Exon v5 capture paired library was sequenced using Illumina HiSeq device. The fastq file (ID 493224) and analysis (ID 3209) bam files have been deposited.

  Dataset EGAD50000001362

• RNA-seq dataset of lung adenocarcinomas

  This dataset includes the RNA-seq data from a study entitled "Tracing Oncogene Rearrangements in the Mutational History of Lung Adenocarcinoma". PolyA tails were captured by Oligo-dT beads, and sequencing run was made in HiSeq 2500 machines. Paired-end FASTQ files are provided in our dataset.

  Dataset EGAD00001004794

• cfMethyl-seq data (cfSort study) from serial plasma samples of NSCLC patients

  The cfMethyl-Seq libraries of the serial plasma cfDNA samples from the four NSCLC patients were constructed following the standard protocol. 10 ng of cfDNA in the volume of 25 µl was used as input material. 5’-end dephosphorylation was done with 3 µl 10xCutSmart buffer and 2 µl quick CIP from NEB (Ipswich, MA) at 37 oC for 30 min then heat-inactivated at 80 oC for 5 min. The 3’-end blocking was done with 0.5 µl 10xCutSmart buffer, 3 µl 2.5 mM CoCl2, 1 µl terminal transferase (all from NEB), and 0.5 µl 1 mM ddGTP at 37 oC for 2 h followed by 75 oC for 20 min. The mixture was then purified with 2x AmpureXP beads (Beckman Coulter, Indianapolis, IN) and eluted in 21.5 µl RT-PCR grade water (Thermo-Fisher, Waltham, MA). Restriction digestion was done with 2.5 µl 10xCutSmart buffer and 1 µl MspI (NEB) for 18 h at 37  oC and 20 min at 65 oC . 0.5 µl 10xCutSmart buffer, 0.3 µl dACGTP mixture (100 mM dATP, 10 mM dCTP, 10 mM dGTP), 1 µl Klenow (exo-, 5U/µl, NEB) and 2.6 µl RT-PCR water, 0.6 µl 50 mM DTT (ThermoFisher) was added to the mixture for end repair and A-overhang addition with the program 30  oC for 20 min, 37 oC for 1 h and 75 oC for 20 min. Adapter ligation was then performed with 1 µl 10xThermoFisher HC T4 ligase buffer, 0.4 µl 100 mM ATP (ThermoFisher), 0.2 µl 50 mM DTT, 1 µl ThermoFisher HC T4 DNA ligase (30 Weiss Unit/µl), 5 ng home-made duplex UMI adapter with all the cytosines methylated (protocol adopted from Kennedy et al.) at 16 oC for 20 h and 65 oC for 20 min. Bisulfite conversion of the adapter-ligated product was carried out with QIAGEN EpiTect plus DNA bisulfite kit following their protocol for two rounds of conversion. The converted product was purified with Qiagen MinElute spin column and eluted with 20 µl RT-PCR water. PCR amplification was done using the NEBNext Multiplex Oligos for Illumina (2.5 µl of universal and index primer each) and 25 µl KAPA HiFi HotStart Uracil+ ReadyMix (Roche) with the following cycling conditions: 98  oC for 45 s, 15 cycles of 98  oC for 15 s, 60  oC for 30 s and 72  oC for 30 s, followed by a final extension at 72  oC for 5 min. The PCR product was purified with 1x AmpureXP beads and eluted with 30 µl EB buffer. DNA concentration was measured by Qubit 1xdsDNA HS assay. 5% TBE-UREA PAGE and bioanalyzer assay was performed as quality control on each library before sequencing.

  Dataset EGAD00001010881

• Transcriptional and Epigenetic Profiles of Male Breast Cancer at Single-Cell Resolution Nominate Salient Cancer Specific Enhancers

  We performed matched single-cell RNA sequencing (scRNA-seq) and single-cell chromatin accessibility sequencing (scATAC-seq) for two fresh human tumors collected from male breast cancer patients. The integration of these datasets revealed the intratumoral heterogeneity in both transcription and chromatin accessibility for each male breast cancer patient and allowed for comparisons to be made between male and female breast cancer. We hope these data will be a useful reference in the field of breast oncology, specifically for the treatment of males, as few studies have explored male breast cancer genetics.

  Study phs003006

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• PETAL Network: Outcomes Related to COVID-19 Treated With Hydroxychloroquine Among Inpatients With Symptomatic Disease (ORCHID) Trial

  ORCHID was a multicenter, blinded, placebo-controlled randomized trial conducted at 34 hospitals in the US between April 2 and June 19, 2020. Adults hospitalized with respiratory symptoms from severe acute respiratory syndrome coronavirus 2 infection were enrolled, with the last outcome assessment on July 17, 2020. The planned sample size was 510 patients with five interim analyses; however, the trial was stopped at the fourth interim analysis for futility with a sample size of 479 patients.The distribution of the day 14 clinical status score (measured using a 7-category ordinal scale) was not significantly different for patients randomized to receive hydroxychloroquine compared with placebo.Instructions for requesting individual-level data are available on BioData Catalyst at https://biodatacatalyst.nhlbi.nih.gov/resources/data/. Apply for data access in dbGaP. Upon approval, users may begin accessing requested data in BioData Catalyst. For questions about availability, you may contact the BioData Catalyst team at https://biodatacatalyst.nhlbi.nih.gov/contact.

  Study phs002299

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Dataset with WGBS data of CRC and colon tissue

  This dataset contains WGBS data from 20 samples, which are either from colorectal cancer or control colon tissue. Sequencing was performed on either Illumina HiSeq 2000 or HiSeq X and the sequences are paired.

  Dataset EGAD50000000772

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• Gene expression adaptation of metastases to their host tissue

  The adaptation of metastatic cells to their host tissue critically determines the pathogenicity of a cancer and therefore patient survival. Yet, it remains elusive to what extent the host environment drives gene expression programs in metastatic cells. Here we identify adaptive mechanisms that enable metastases to establish themselves in a novel tissue context. We performed single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis to deduce tissue adaptive expression patterns. A novel computational approach identified genes and pathways that consistently adapted to the host tissue at the transition from the primary tumor to the paired metastasis across donors. This analysis revealed that the majority of expression changes in the metastasis reflect an expression signature reminiscent of benign liver epithelial cells. Cellular processes adapting to the liver environment include basic cellular functions such as energy metabolism, as well as tissue-specific pathways such as the regulation of lipid metabolism by PPAR-α. These adaptations potentially increase the pathogenicity of the metastatic cells and may provide new therapeutic strategies.

  Study EGAS50000000817

• Genome-wide quantification of rare somatic mutations in normal human tissues using massively parallel sequencing

  We present Bottleneck Sequencing System (BotSeqS), a nextgeneration sequencing method that simultaneously quantifies rare somatic point mutations across the mitochondrial and nuclear genomes. BotSeqS combines molecular barcoding with a simple dilution step immediately prior to library amplification. We use BotSeqS to show age and tissue-dependent accumulations of rare mutations and demonstrate that somatic mutational burden in normal tissues can vary by several orders of magnitude, depending on biologic and environmental factors. We further show major differences between the mutational patterns of the mitochondrial and nuclear genomes in normal tissues. Lastly, the mutation spectra of normal tissues were different from each other, but similar to those of the cancers that arose in them. This technology can provide insights into the number and nature of genetic alterations in normal tissues and can be used to address a variety of fundamental questions about the genomes of diseased tissues.

  Study EGAS00001001838

• iCope fastq files

  The data set contains the fastq files of the single cell RNAseq study associated with the iCope manuscript. There are fastq files for gene expression and for tcr enrichment for each sample.

  Dataset EGAD50000001645

• Predictive value of chromosome 18q11.2-q12.1 loss for benefit from bevacizumab in metastatic colorectal cancer; a post-hoc analysis of the randomized controlled trial AGITG-MAX

  Patients and methods: We analyzed tumor samples of 256 patients enrolled in the AGITG-MAX 3-arm randomized controlled trial (RCT) who were randomly assigned to receive either capecitabine, or capecitabine and bevacizumab with- or without mitomycin. Chromosome 18q11.2-q12.1 copy number status was measured and correlated with PFS according to a predefined analysis plan with marker-treatment interaction as the primary end-point.Results: Chromosome 18q11.2-q12.1 losses were detected in 71% of patients (181/256) characteristic for mCRC. Consistent with the non-randomized study, significant PFS benefit of bevacizumab was observed in chromosome 18q11.2-q12.1 loss patients (P=0.009), and not in 18q no-loss patients (P=0.67). Although significance for marker-treatment interaction was not reached (Pinteraction = 0.28), hazard ratio and 95% confidence interval (HRinteraction 0.72, CI 0.39 - 1.32) show striking overlap with the non-randomized study cohorts (HRinteraction 0.41, CI 0.32 - 0.8) supported by a non-significant Cochrane chi-squared (P=0.11) for heterogeneity. Conclusions: PFS characteristics for marker positive- and negative patients randomized for treatment with- or without bevacizumab were consistent with those of the non-randomized discovery study, though the number of AGITG-MAX samples fell short to reach significance for marker-treatment interaction. Post-hoc analysis of the AGITG-MAX RCT provides supportive evidence for chromosome 18q11.2-q12.1 as a clinically relevant predictive marker for mCRC patients.

  Study EGAS00001005453

• Molecular profiling of tissue autopsies and ctDNA

  The dataset contains high-throughput sequencing data derived from a cancer autopsy series of 10 patients. As part of this study, whole-exome sequencing and RNA-seq were performed for spatially distinct tissue biopsies from the patients. In addition, plasma samples from the patients were sequenced using a custom panelt to profile ctDNA. There are 106 files containing whole-exome sequencing data, 107 files containing RNA-seq data, and 9 files containing plasma sequencing data.

  Dataset EGAD00001007040

• Peter Van Loo MPNST phase 1

  We comprehensively profile a primary malignant peripheral nerve sheath tumour (MPNST) and its recurrence with a multi-omic and spatial approach at single-cell resolution. Leveraging the extensive heterogeneity in copy number aberrations (CNAs) as a native barcoding system, we fully resolve the evolutionary tree of this tumour revealing multi-furcations suggestive of ongoing chromosomal instability. We show gene dosage effects contribute to phenotypic diversity and are predominantly linear. Using laser capture microdissection, we performed spatial lineage tracing in a human tumour, elucidating the relationship between local expansions and interactions between tumour cells and the microenvironment.

  Dac EGAC50000000904

• Mate pair whole genome sequencing of 98 AML samples

  This dataset contains bam-files from Mate-pair whole genome sequencing of 98 AML samples. DNA was extracted from either bone marow or peripheral blood from primary AML samples. The libraries were prepared using Illumina Nextera mate pair library preparation kit, generating long-insert (2-8 kb) paired end libraries. These were sequenced on an Illumina NextSeq 500 using 2x76bp paired end chemistry. The fastq files generated by sequencing were aligned to the human hg19 reference genome (ucsc.hg19.fasta from the GATK resource bundle) using bwa (0.7.15-r1140) and duplicate reads were identified using samblaster (0.1.24).

  Dataset EGAD50000001574

• Analysis of Cell-Free DNA to Predict Outcome to Bevacizumab Combination Therapy in Metastatic Colorectal Cancer Patients

  This dataset includes FASTQ files of low coverage whole genome sequencing of normal tissue (n = 8), tumor tissue (n = 55) and cell free DNA from plasma samples (n=101) from patients with metastatic colorectal cancer treated with bevacizumab. A total of 164 samples are present from two different cohorts. The first batch of samples (n = 139, sample names sAPD302T until sAPD502_P0) were collected from the AC-Angiopredict Phase 2 trial (NCT01822444), the second batch of samples (n = 25m, sample names sAPD503_P0 until sAPD527_P0) were collected from the UMM cohort.

  Dataset EGAD50000000176

• Single-cell RNA and DNA sequencing data obtained after genome-and-transcriptome separation.

  This dataset contains single-cell RNA and DNA sequencing data (fastq, n=928) obtained after genome-and-transcriptome separation. The RNA-seq data was obtained by Smart-seq2 amplification and Nextera XT library preparation. The DNA-seq data was obtained either by Gtag library preparation and amplification or by PicoPlex whole-genome amplification followed by Nextera XT library preparation. The single cells originate from a human PDX melanoma model and from HCC38 and HCC38 BL cell lines. The sequencing libraries were sequenced with Illumina instruments.

  Dataset EGAD00001010096

• Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia [scRNAseq]

  This dataset contains single-cell RNA, individually reference-aligned data from 203 individuals representing four Indonesian populations: the general urban population of Denpasar and the traditional community of Pedawa Village in Bali, as well as the traditional community of Yoboi Village (in Lake Sentani) and Sereh Village (individuals from highland Papua residing near Lake Sentani) in Papua. The dataset was produced as part of the Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia, a study aimed at characterizing how genetic background and environmental context shape immune cell states across diverse Indonesian communities.

  Dataset EGAD50000002385

• Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia [TCR]

  This dataset contains single-cell TCR, individually reference-aligned data from 203 individuals representing four Indonesian populations: the general urban population of Denpasar and the traditional community of Pedawa Village in Bali, as well as the traditional community of Yoboi Village (in Lake Sentani) and Sereh Village (individuals from highland Papua residing near Lake Sentani) in Papua. The dataset was produced as part of the Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia, a study aimed at characterizing how genetic background and environmental context shape immune cell states across diverse Indonesian communities.

  Dataset EGAD50000002383

• Whole exome sequencing data from 120 AML samples

  This dataset contains bam-files from whole exome sequencing of 120 paired tumor-normal pairs from AML. Tumor DNA was extracted from either bone marow or peripheral blood from primary AML samples. Normal DNA was extracted from cultured skin fibroblast samples. The libraries were prepared using the Nextera rapid capture exome kit and sequenced on an Illumina NextSeq 500 using 2x151bp paired end chemistry. The fastq files generated by sequencing were aligned to the human hg19 reference genome (ucsc.hg19.fasta from the GATK resource bundle) using bwa (0.7.9a-r786 or 0.7.15-r1140) and duplicate reads were identified using samblaster (0.1.24).

  Dataset EGAD50000001575

• Lactobacillus rhamnosus GG ATCC (LGG) as an immune adjuvant for influenza vaccination in the elderly

  Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs placebo in elderly receiving Trivalent Inactivated Influenza Vaccine (TIV) (study 1) or Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs. placebo in elderly subjects receiving Live Attenuated Influenza vaccine (LAIV) (study 2). Healthy elderly volunteers, ages 65-80 were enrolled as outpatients in two clinical studies in which they received the TIV vaccine (study 1, n=28) or the LAIV vaccine (study 2, n=30). In each of the 2 studies, subjects were randomized to receive either LGG capsules containing 1 x 1010 CFU, twice daily for 28 days, or matching placebo capsules twice daily for the same period of time. The study subjects completed a daily diary, telephone calls, and study visits at the Massachusetts General Hospital Clinical Research Centers at baseline, days 21, 28 and 56 and month 5 for the TIV study and baseline, days 21, 28, and 56 for the LAIV study. During each visit, the subject diary, interim history, potential adverse effects and concomitant medications were reviewed and vital signs and a physical examination were performed. Routine blood tests were obtained to monitor for safety during visits and nasopharyngeal and stool samples were collected for microbiome analysis. Volunteers in both studies who were interested in participating in the effect of LGG probiotic on the Human whole Blood Transcriptome substudy also had blood drawn for DNA and RNA extraction, after signing the substudy consent form. The main objectives of the TIV and LAIV studies were to assess the safety and tolerability of 2 x 1010 CFU LGG administered orally to elderly subjects for 28 days after administration of TIV (study 1) or LAIV (study 2). Secondary objectives were to evaluate the richness and microbial diversity in nasopharyngeal and stool specimens using pyrosequencing, and to compare cytokine production in response to bacterial stimulation by following the kinetics of mRNA expression of pro and anti-inflammatory genes and different signaling pathways, in relation to changes in stool Bifidobacterium and Lactobacillus spp. The studies were reviewed and approved by the Partners Human Research Committee (TIV study IRB # 2010p001694 and LAIV study IRB # 2011p002849) and were registered at ClinicalTrials.gov (NCT01368029 and NCT01545349, respectively).

  Study phs000981

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• Oncogenic chimeric transcription factors drive tumor-specific transcription, processing, and translation of silent genomic regions

  Many cancers are characterized by gene fusions encoding oncogenic chimeric transcription factors (TFs) such as EWS::FLI1 in Ewing sarcoma (EwS). Here, we find that EWS::FLI1 induces the robust expression of a specific set of novel spliced and polyadenylated transcripts within otherwise transcriptionally silent regions of the genome. These neogenes (NGs) are virtually undetectable in large collections of normal tissues or non-EwS tumors and can be silenced by CRISPR interference at regulatory EWS::FLI1-bound microsatellites. Ribosome profiling and proteomics further show that some NGs are translated into highly EwS-specific peptides. More generally, we show that hundreds of NGs can be detected in diverse cancers characterized by chimeric TFs. Altogether, this study identifies the transcription, processing, and translation of novel, specific, highly expressed multi-exonic transcripts from otherwise silent regions of the genome as a new activity of aberrant TFs in cancer.

  Study EGAS00001006293

• Japanese Alzheimer's disease neuroimaging initiative

  Japanese ADNI aims to establish imaging and biofluid markers that can predict and monitor the progression of changes in the brains of elderly individuals with AD, mild cognitive impairment (MCI) or normal cognition, and eventually be used as a surrogate markers for the clinical trials of DMDs for AD.

  Study JGAS000051

• RNA-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for the indicated number of days (Donor: 0 day, 12d: 12 days, 2m: 2 months, 3m: 3 months), then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-, CD38m: CD38-, CD38m: CD38-).

  Study EGAS00001006512

• DNA methylation (RRBS) data for the validation the glioblastoma progression study (GBMatch).

  Genome-wide profiling of DNA methylation levels by RRBS in 150 glioblastoma tumor samples. Patients were selected to represent the general population of glioblastoma patients based on Austrian Brain Tumor Registry. These DNA methylation profiles were created for the validation of the glioblastoma progression study (GBMatch) and consist of 106 profiles from FFPE samples and 44 profiles from fresh-frozen samples. For the 44 fresh-frozen samples also WGS data (43 genomes) and RNA-seq data (37 transcriptomes) have been produced for validation purposes.

  Dataset EGAD00001004074

• Digital tEchnology For Lung Cancer Treatment

  DEFLeCT metadata: 1) A table containing the mutational profile for all human genes across the cohort of the 81 PROMOLE lung cancer samples. 2) A table containing the expression levels for all human genes across the cohort of the 81 PROMOLE lung cancer samples. 3) A table containing the clinical, histology data and follow-ups of the cohort of 81 PROMOLE lung cancer patients.

  Dataset EGAD00001010838