19477 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 54.86 milliseconds.

• Reproducibility of variant calls in replicate next generation sequencing experiments

  To examined the reproducibility of nucleotide variant calls in replicate sequencing experiments of the same genomic DNA, we performed targeted sequencing of all known human protein kinase genes (kinome) (~3.3 Mb) using the SOLiD v4 platform. This data set contains 17 breast cancer samples that were sequenced in duplicate (n=14) or triplicate (n=3), in order to assess concordance of all calls and single nucleotide variant (SNV) calls.

  Dataset EGAD00001001209

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Dataset EGAD00001002186

• A case of colorectal cancer with ERBB2 c.2264T>C (p.Leu755Ser) mutation

  This data set contains next generation sequencing (NGS) data of two serial tumor samples (primary and a metastasis) from a patient with colorectal cancer showing an ERBB2 c.2264T>C (p.Leu755Ser). NGS was performed using the Illumina TruSeq Amplicon Cancer Panel (TSACP, Illumina) covering 212 amplicons in 48 cancer associated genes on the Illumina MiSeq sequencing platform. The dataset contains two BAM files.

  Dataset EGAD00001002252

• The BNT162b2 mRNA COVID-19 vaccine induces long-term effects on both adaptive and innate immune responses

  This dataset contains bulk RNA sequencing at different timepoints post-BNT162b2 mRNA COVID-19 vaccination. Stimulation experiments were performed at each of the timepoints (RPMI, Influenza, R848 and Influenza stimuli), resulting in 242 libraries distributed over 4 stimulations and 4 timepoints. Libraries were sequenced on the DBNSEQ platform.

  Dataset EGAD00001011042

• CATHeterization GENetics (CATHGEN)

  The CATHGEN biorepository consists of biological samples collected on 9334 sequential consenting individuals undergoing cardiac catheterization at Duke University Medical Center between 2001 and 2010 inclusive. The Institutional Review Board informed consent allowed for 50 mL of blood to be collected from fasting patients through the femoral arterial sheath during the catheterization procedure. Three 7.5 mL EDTA tubes for DNA extraction are stored at -80°C. The Duke Database for Cardiovascular Disease (DDCD) provides the bulk of the clinical data used for analysis. Follow-up includes mortality information gleaned from the National Death Index and Social Security Death Index plus follow-up phone calls and written questionnaires regarding MI, stroke, re-hospitalization, coronary re-vascularization procedures, smoking, exercise, and medication use.

  Study phs000703

• Impact of cryopreservation on transcriptome analysis of peripheral blood mononuclear cells

  To investigate the effect of cryopreservation on PBMCs, we conducted an experiment using samples from three healthy donors under four conditions: fresh PBMCs, PBMCs subjected to a single freeze–thaw cycle, PBMCs refrozen in freezing mix, and PBMCs refrozen in TRIzol. This resulted in a total of 12 samples (three replicates per condition). RNA was extracted from all PBMC samples using the Qiagen miRNeasy Mini Kit, followed by polyA RNA sequencing on the Illumina NovaSeq 6000 platform. Blood was collected from one male and two female adult donors. Sequencing yielded high-quality data, with an average of 27.8 million reads per sample and over 94% of bases exceeding a Q30 quality score.

  Study EGAS50000001196

• HiDEF-seq single-molecule sequencing of single-strand mismatches and damage

  Our study sought to resolve, with single-molecule fidelity, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detect base substitutions when present in either one or both DNA strands. We also detect cytosine deamination, a common type of DNA damage, with single-molecule fidelity. This study profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.

  Study EGAS50000000318

• BRAF_and_MEK_resistant_cell_line_clones

  The Sanger Institute has the largest collection of genetically-characterised cancer cell lines world-wide (we have collected >1000 human cancer cell lines which are being screened against >400 cancer therapeutics (http://www.sanger.ac.uk/genetics/CGP/translation). These lines have been characterized to the level of gene copy number, gene expression and cancer gene mutation sequence data. This has enabled us to select melanoma lines with varying BRAF mutational status and that show sensitivity to a range of BRAF inhibitors. Sensitive lines are being used to generate resistant clones by serial exposure to increasing concentrations of BRAF and MEK inhibitors and these are being characterised by genome-wide copy number analysis as well as by whole exome sequencing.

  Study EGAS00001000172

• Type 1 Diabetes Genetics Consortium (T1DGC): ImmunoChip Study

  The Type 1 Diabetes Genetics Consortium (T1DGC) was formed to address issues of limited sample size and consistency of phenotyping that had limited genetic investigations on risk of type 1 diabetes (T1D). The T1DGC first collected affected sib pair (ASP) families from four geographic networks (Asia-Pacific, Europe, North America, United Kingdom). In addition, T1D cases and controls were ascertained from existing and de novo collections. The T1DGC assembled 2,601 T1D ASP families and 69 Parent-T1D offspring trios, T1D cases from the UK Genetic Resource Investigating Diabetes (UKGRID, N=6,670), and controls from the British 1958 Birth Cohort (B58BC, N=6,523), the UK National Blood Services collection (NBS, N=2,893) and the NIHR Cambridge Biomedical Research Centre BioResource (CBR, N=2,846). All samples included in this series have reported or self-declared European ancestry. All DNA samples were collected after approval from relevant institutional research ethics committees. Genotyping was performed using a custom Illumina Infinium high-density genotyping array, ImmunoChip (Illumina, Inc; CA) according to manufacturer's protocols. The ImmunoChip was designed to densely genotype, using 1000 Genomes and any other available disease specific resequencing data, immune-mediated disease loci identified by common variant GWAS. The ImmunoChip Consortium selected 186 distinct loci containing markers meeting genome wide significance criteria (P<5x10-8) from twelve such diseases (autoimmune thyroid disease, ankylosing spondylitis, Crohn's disease, celiac disease, IgA deficiency, multiple sclerosis, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, T1D and ulcerative colitis). All 1000 Genomes Project pilot phase CEU population variants (Sept 2009 release) within 0.1cM (HapMap3 CEU) recombination blocks around each GWAS region lead marker were submitted for array design. No filtering on correlated variants (linkage disequilibrium) was applied. Additional content included regional resequencing data (submitted by several groups) as well as a small proportion of investigator-specific undisclosed content including intermediate GWAS results. After data cleaning and quality control, a total of 154,939 single nucleotide polymorphisms (SNPs) from 186 loci on ImmunoChip were scored. Case-control and family data were analyzed independently and combined by meta-analysis.

  Study phs000911

• Measuring the level of relatedness between NGS datasets

  Sequencing technologies are providing increasingly detailed insight in genetic makeup are paving their way into molecular diagnostics. The field will benefit from rigorous and bias-free measures for the quality of sequence data and for the proper representation of the complexity of the original samples. While current methodologies rely on the availability of a well-characterized reference genome, we propose kMer profiling for alignment-free assessment of the quality, comparability, and complexity of sequencing datasets. We show that kMer detects technical artefacts such as high duplication rates, library chimaeras, and differences in library preparation protocols in whole-genome, whole-exome, and RNA sequencing data. Additionally, it successfully captures the complexity and diversity of microbiomes. Thus, kMer allows for a robust evaluation of the quality and complexity of sequencing data without relying on any prior information and opens the way to a more reliable biological reasoning.

  Study EGAS00001000600

• Archive growth Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue In this section, we expose the overall volume of data available to download and the different archived file types. EGA Archive growth in size and number of files The below figure represents the EGA archive growth in size (TB) and number of files. EGA Archive Growth per year lineChart('ega-archive-growth', 'https://stats.ega-archive.org/growth/archive', ['Volume (TB)'], ['T']) Archive files The below figure represents on a initial level, the percentage of archived files by data technology. The second level, acessible by clicking in the required extension, displays the number of files by extension archived in the ega archive. Please click over the extension to learn more about the files. EGA Archived Files barChart('ega-archived-files', 'https://stats.ega-archive.org/extensions', false ,'', true)

  Documentation about/statistics/archive

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Whole-exome sequencing data from breast cancer recurrence, endometrial cancer, and colon tumor samples harboring a rare germline BARD1 variant

  This dataset comprises whole-exome sequencing data from tumor and matched blood samples of a patient with breast cancer recurrence and endometrial cancer carrying a germline BARD1 p.(Gly753Val) variant, as well as from the colon tumor of the proband's father

  Dataset EGAD50000002412

• Indigenous American Genomic Diversity Project (IAGDP).

  Here we present the Indigenous American Genomic Diversity Project (IAGDP), comprising 128 newly generated high-coverage (NGS; ~44X) whole genomes from Indigenous individuals across eight Latin American countries, representing 45 populations and 28 language families. This dataset expands Indigenous representation in genomics, with emphasis on geographically and linguistically diverse populations, particularly from the South American lowlands.

  Dataset EGAD50000002396

• Whole-genome sequencing data of metastatic salivary gland cancer

  This dataset contains whole-genome sequencing data of three patients with metastatic salivary gland cancer who underwent autopsy to harvest tumor biopsies from spatially separated metastatic sites and biopsies from healthy skin as a control. Two patients had the subtype adenoid cystic carcinoma (patients 1 and 4) and one patient had the subtype myoepithelial carcinoma.

  Dataset EGAD50000002056

• Targeted DNA sequencing of TTFields-treated glioblastoma, IDH wildtype

  This dataset contains raw paired-end FASTQ files from targeted DNA sequencing using the TruSight Oncology 500 panel in patients with glioblastoma, IDH wildtype, treated with surgery, standard chemoradiotherapy and Tumor Treating Fields at Charité – Universitätsmedizin Berlin. Tumour samples were collected at first surgery and are linked to pseudonymised clinical and molecular annotations described in the associated EGA study.

  Dataset EGAD50000002117

• Whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients

  This dataset contains whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients. Whole exome sequencing with a minimum coverage of 100x was performed using the Illumina Novaseq6000 platform and the Agilent SureSelect Human All Exon V7 kit.

  Dataset EGAD50000002264

• Total RNA sequencing of fibroblasts from an control individual

  Total RNA sequencing of fibroblasts from an individual with 30-55x GCC repeats in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000922

• Disease recurrence after pathologic response

  In this study we aim to gain insight into the mechanisms of immune evasion after initial pathologic response to neoadjuvant immune checkpoint inhibition in macroscopic stage III melanoma by pooling data of the neoadjuvant OpACIN, OpACIN-neo and PRADO trials. Therefore we analyzed in-depth paired baseline and recurrent tumor samples through a.o. DNA sequencing analyses.

  Dataset EGAD50000000699

• Gene panel sequencing of paired samples from primary and relapsed IDH-wt glioblastomas

  This dataset contains gene panel sequencing data from 43 sample pairs of primary and relapsed IDH-wt glioblastomas. The gene panel covers 50 glioma-associated genes. 14 of the sequenced sample pairs were sequenced with whole genome sequencing also and are accessible under EGAD00001004563.

  Dataset EGAD00001004565

• LBC1936 VCF

  LBC1921 and LBC1936 GVCFs called with GATK's HaplotypeCaller were combined and subject to variant quality score recalibration. This VCF contains the subset of samples (n = 1068) from the LBC1936 cohort.

  Dataset EGAD00001005478

• He et al. RNA-seq data

  This dataset are the bam files of RNA-seq data from the paper by He et al.

  Dataset EGAD00001007135

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007516

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007515

• Post Mortem brain data used in paper "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing"

  This dataset contains data used in the paper titled "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing. The data consists of one post mortem sample that was sequenced with direct RNA sequencing form Oxford Nanopore Technologies on a promethION flow cell.

  Dataset EGAD00001009308

• Leukemia Data Access committee for the deposited data. The committee consists of the principal investigators for the data set.

  Dac EGAC00001003565

• Collaborative Cohort of Cohorts for COVID-19 Research (C4R): Atherosclerosis Risk in Communities Study (ARIC)

  Cohort Description The Atherosclerosis Risk in Communities (ARIC) study began in the mid-1980s with the initial aims being to describe the presence of subclinical atherosclerosis, the progression of atherosclerosis to clinical cardiovascular disease (CVD), and the association of novel risk factors with CVD. ARIC recruited its cohort of men and women aged 45-64 in 1987-89 from four communities (Forsyth County, NC; Jackson, MS; suburban Minneapolis, MN; and Washington County, MD). As of 2025, ARIC counts over 4,000 participants.Data Submitted Wave 1 questionnaire data includes 356 variables for up to 5763 ARIC participants in C4R. Wave 2 questionnaire data includes 367 variables for up to 5000 ARIC participants in C4R. Wave 3 questionnaire data includes 81 variables for up to 3450 participants in C4R.Dried Blood Spot/Serosurvey data includes 8 variables for up to 2437 ARIC participants in C4R. Derived data includes 62 variables for up to 18765 observations. Phenotype data includes 163 variables for up to 5937 ARIC participants in C4R. Brain MRI data includes 13 variables for up to 2550 participants in C4R.HCU data includes 21 variable for up to 631 ARIC participants in C4R.Lung CT data includes 15 variables for 1329 ARIC participants in C4R.Neurocognitive data includes 16 variables and 49826 observations.Serosurvey data includes 20 variables for 1707 ARIC participants in C4R.

  Study phs002988

• Integrative and comparative genomic analyses identify clinically relevant groups of pulmonary carcinoids and unveil the supra-carcinoids

  Multi-omic data for lung neuroendocrine neoplasms, including the first multi-omic sequencing data for the understudied lung atypical carcinoids. The data includes Whole-exomes, whole-genomes, RNA-seq, and EPIC 850K methylation array data.

  Study EGAS00001003699

• Next Generation Sequencing platform for targeted Personalized Therapy of Leukemia - Acute myeloid leukemia

  The advent of high-throughput next generation sequencing (NGS) technologies that are revolutionizing genomics and transcriptomics by providing a single base resolution tool for a unified deep analysis of diseases complexity allows a fast and cost-efficient fine-scale assessment of the genetic variability hidden within cohorts of patients affected by the same leukemia. That being so, by potentially highlighting inter-individual differences that may play a role in the differential success of diverse therapeutic interventions, they promise to be crucial for selecting the most appropriate medical treatments. The project aims at the identification of novel prognostic biomarkers for acute myeloid leukemia (AML) and studied the molecular differences between aneuploid and euploid AML.

  Study EGAS00001005464

• ATAC-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for 3-4 months, then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-)

  Study EGAS00001006511

• The dataset for "Validation of cfDNA fragmentome analyses for early detection of liver cancer"

  The dataset for “Validation of cfDNA fragmentome analyses for early detection of liver cancer” includes 380 cram files from whole genome next-generation sequencing on the Illumina NovaSeq 6000 with 10x coverage. The samples analyzed include plasma samples from patients with cancer and liver disease.

  Dataset EGAD00001015538

• Whole exome and transcriptome sequencing of BPDCN

  This data set contains whole exome and transcriptome data from 47 case with BPDCN. For exome data, bam files are provided (mapped against GRCh38), for transcriptome raw fastq-files (paired-end data).

  Dataset EGAD00001008692

• Genotype variables of the 61 COVID-19 patient cohort used in the main project of data integration

  We selected SNPs with a minor allele frequency (MAF) higher than 10% in the Caucasian population from the Ensembl database. Specifically, we selected ACE2 (rs2285666), MX1 (rs469390), and TMPRSS2 (rs2070788) for the present analysis. For more information, please refer to:

  Study EGAS50000000589

• Understanding human fetal pancreas development using subpopulation sorting and RNA sequencing

  To decipher the populations of cells present in the human fetal pancreas and their lineage relationships, we developed strategies to isolate pancreatic progenitors, endocrine progenitors and endocrine cells. Transcriptome analysis of the individual populationsrevealed a large degree of conservation among vertebrates in the drivers of gene expression changes occurring at different steps of differentiation, althoughnotably, sometimes, different members of the same gene family are expressed. The transcriptome analysis establishes a resource to identify novel genes and pathways involved in human pancreas development. Single cell profiling further captured intermediate stages ofdifferentiation and enabled us to decipher the sequence of transcriptional events occurring during human endocrine differentiation. Furthermore, we evaluate how well individual pancreatic cells derived in vitro from human pluripotent stem cells mirror the natural processoccurring in human fetuses. This comparison uncovers a few differences at the progenitor steps, a convergence at the steps of endocrine induction and the current inability to fully resolve endocrine cell subtypes in vitro.

  Study EGAS00001003127

• The characterization of gene expression pattern of anticancer agent-resistant cancer stem cells using RNA sequencing analysis.

  Slow cycling cancer stem cells persist and contribute to tumor regrowth after chemotherapy.To investigate this mechanism, we developed stemness- and cell cycle-visualized colon cancer organoids from patient tissues, and perfomed comparative transcriptome analysis using sorted rapid cycling stem cells (LGR5+p27-) and slow cycling stem cells (LGR5+p27+). In addition, we analyzed the changes in the gene expression patterns in the slow cycling stem cells and all of tumor cells after chemotherapy (camptothecin) treatment. Gene ontology analysis and gene set enrichment analysis using these transcriptome data revealed cell adhesion signal and YAP siganling pathway were important to maintain the dormancy and resume propagation after chemotherapy. In each experiments, total RNA was extracted from organoids and sequenced with HiSeq X Ten (Illumina).

  Study JGAS000350

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• cfMethyl-seq data (cfSort study) from serial plasma samples of NSCLC patients

  The cfMethyl-Seq libraries of the serial plasma cfDNA samples from the four NSCLC patients were constructed following the standard protocol. 10 ng of cfDNA in the volume of 25 µl was used as input material. 5’-end dephosphorylation was done with 3 µl 10xCutSmart buffer and 2 µl quick CIP from NEB (Ipswich, MA) at 37 oC for 30 min then heat-inactivated at 80 oC for 5 min. The 3’-end blocking was done with 0.5 µl 10xCutSmart buffer, 3 µl 2.5 mM CoCl2, 1 µl terminal transferase (all from NEB), and 0.5 µl 1 mM ddGTP at 37 oC for 2 h followed by 75 oC for 20 min. The mixture was then purified with 2x AmpureXP beads (Beckman Coulter, Indianapolis, IN) and eluted in 21.5 µl RT-PCR grade water (Thermo-Fisher, Waltham, MA). Restriction digestion was done with 2.5 µl 10xCutSmart buffer and 1 µl MspI (NEB) for 18 h at 37  oC and 20 min at 65 oC . 0.5 µl 10xCutSmart buffer, 0.3 µl dACGTP mixture (100 mM dATP, 10 mM dCTP, 10 mM dGTP), 1 µl Klenow (exo-, 5U/µl, NEB) and 2.6 µl RT-PCR water, 0.6 µl 50 mM DTT (ThermoFisher) was added to the mixture for end repair and A-overhang addition with the program 30  oC for 20 min, 37 oC for 1 h and 75 oC for 20 min. Adapter ligation was then performed with 1 µl 10xThermoFisher HC T4 ligase buffer, 0.4 µl 100 mM ATP (ThermoFisher), 0.2 µl 50 mM DTT, 1 µl ThermoFisher HC T4 DNA ligase (30 Weiss Unit/µl), 5 ng home-made duplex UMI adapter with all the cytosines methylated (protocol adopted from Kennedy et al.) at 16 oC for 20 h and 65 oC for 20 min. Bisulfite conversion of the adapter-ligated product was carried out with QIAGEN EpiTect plus DNA bisulfite kit following their protocol for two rounds of conversion. The converted product was purified with Qiagen MinElute spin column and eluted with 20 µl RT-PCR water. PCR amplification was done using the NEBNext Multiplex Oligos for Illumina (2.5 µl of universal and index primer each) and 25 µl KAPA HiFi HotStart Uracil+ ReadyMix (Roche) with the following cycling conditions: 98  oC for 45 s, 15 cycles of 98  oC for 15 s, 60  oC for 30 s and 72  oC for 30 s, followed by a final extension at 72  oC for 5 min. The PCR product was purified with 1x AmpureXP beads and eluted with 30 µl EB buffer. DNA concentration was measured by Qubit 1xdsDNA HS assay. 5% TBE-UREA PAGE and bioanalyzer assay was performed as quality control on each library before sequencing.

  Dataset EGAD00001010881

• RNA-Seq for SF3B1 splicing signature

  This dataset includes exome-captured RNA-Seq made with exome v8 (Agilent) - library preparation on a MAGNIS XT-HS2 starting from 100ng of RNA. RNA has been extracted from lymphocytes cultures from 2 probands with SF3B1 mutations and 14 controls. All 16 RNA-Seq were sequenced on a single HighOutput flowcell 2x75bp (NextSeq550). Raw fastq files have between 20 and 30M paired-reads.

  Dataset EGAD50000002121

• DNA methylation changes associated with hyperglycemia in type 1 diabetes

  This dataset includes DNA methylation profiles from 112 young with Type 1 Diabetes (T1D) at T1D diagnosis, who were longitudinally monitored for hyperglycemia over an average duration of 3 years. These datasets were generated using whole-genome bisulfite sequencing. It includes 1872 fastq files (i.e. 936 paired-end fastq files) generated through 150 bp paired-end sequencing on Illumina HiSeqX.

  Dataset EGAD50000000545

• WES and RNAseq dataset

  This dataset includes WES and RNAseq for 7 patients with metastatic melanoma (4), non-small cell lung adenocarcnioma (1), cervix adenocarcinoma (1), and Epidermoid nasophaeyngeal carcinoma (1), enrolled in phase I clinical trials (NCT03475134m NCT04643574 and NCT05195619). WES was performed on matched cancer and healthy tissues, whereas RNAseq was performed on cancer tissues, using Illumina HiSeq 4000/6000 and Illumina NextSeq 500/550 systems.

  Dataset EGAD50000000337

• Transcriptome sequencing of myelodysplasia

  Transcriptome sequencing was performed on 214 patients with myelodysplasia in this study. RNA was obtained from bone marrow CD34+ cells (n=100) and/or bone marrow mononuclear cells (n=165). Transcriptome sequencing was performed for both cell fractions in 51 patients. A total of 211 patients were genotyped by targeted deep sequencing. We also studied bone marrow CD34+ cells and bone marrow mononuclear cells obtained from three healthy adults each.

  Dataset EGAD00001003891

• RNAseq of neuroblastoma PDX and cell lines

  This dataset contains 72 RNAseq (BAM and Fastq files are available for each sample).

  Dataset EGAD00001006558

• OCCAMS_Oesophageal Cancer Organoids_1

  ***THIS DATA CAN ONLY BE USED FOR NON-COMMERCIAL CANCER RESEARCH*** Sequencing of organoid cell lines derived from oesophageal tumour sections taken from patients diagnosed with primary oesophageal cancer who underwent tumour resection surgery.

  Dataset EGAD00001001889

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726