19278 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 44.18 milliseconds.

• A case of colorectal cancer with ERBB2 c.2264T>C (p.Leu755Ser) mutation

  This data set contains next generation sequencing (NGS) data of two serial tumor samples (primary and a metastasis) from a patient with colorectal cancer showing an ERBB2 c.2264T>C (p.Leu755Ser). NGS was performed using the Illumina TruSeq Amplicon Cancer Panel (TSACP, Illumina) covering 212 amplicons in 48 cancer associated genes on the Illumina MiSeq sequencing platform. The dataset contains two BAM files.

  Dataset EGAD00001002252

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Dataset EGAD00001002186

• Detecting PKD1 variants in Polycystic Kidney Disease patients by single-molecule long-read sequencing

  Cohort of 19 ADPKD patients characterized using long-read sequencing. The variant identification provided high sensitivity in identifying PKD1 pathogenic variants, with a diagnostic yield of 94.7%. This dataset includes all sequencing data (BAM files) of the 19 patients, in addition to their raw variants (unfiltered) obtained from the long-read sequencing as well as Sanger sequencing (VCF file).

  Dataset EGAD00001003103

• Reproducibility of variant calls in replicate next generation sequencing experiments

  To examined the reproducibility of nucleotide variant calls in replicate sequencing experiments of the same genomic DNA, we performed targeted sequencing of all known human protein kinase genes (kinome) (~3.3 Mb) using the SOLiD v4 platform. This data set contains 17 breast cancer samples that were sequenced in duplicate (n=14) or triplicate (n=3), in order to assess concordance of all calls and single nucleotide variant (SNV) calls.

  Dataset EGAD00001001209

• Impaired HLA Class I Antigen Processing and Presentation as a Mechanism of Acquired Resistance to Immune Checkpoint Inhibitors in Lung Cancer

  Mechanisms of acquired resistance to immune checkpoint inhibitors (ICIs) are poorly understood. The purpose of this study was to investigate whether alterations in genes encoding components of the HLA Class I antigen processing and presentation machinery or interferon signaling pathways play a role in acquired resistance to PD-1 or PD-L1 antagonistic antibodies. Whole exome sequencing was performed on tumor samples collected from patients with advanced non-small cell lung cancer at the time of resistance to PD-1 axis inhibitors and on available matched pre-treatment and normal samples. Patient-derived xenografts successfully established from the ICI-resistant samples were also exome sequenced. Additionally, RNA sequencing was performed on cases with sufficient tissue.

  Study phs001464

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Cancer-independent, second somatic NF1 mutation of normal tissues in neurofibromatosis type 1

  Cancer predisposition syndromes mediated by recessive cancer genes generate tumours via somatic variants (second hits) in the unaffected allele. Second hits may or may not be sufficient for neoplastic transformation. Here, we performed whole genome and exome sequencing on 479 tissue biopsies from a child with neurofibromatosis type 1, a multi-system cancer-predisposing syndrome mediated by constitutive monoallelic NF1 inactivation. We identified multiple independent NF1 driver variants in histologically normal tissues, but not in 610 biopsies from two non-predisposed children. We corroborated this finding using targeted duplex sequencing, including a further nine adults with the same syndrome. Overall, truncating NF1 mutations were under positive selection in normal tissues from individuals with neurofibromatosis type 1. We demonstrate that normal tissues in neurofibromatosis type 1 commonly harbour second hits in NF1, the extent and pattern of which may underpin the syndrome's cancer phenotype.

  Dataset EGAD00001015398

• Impact of cryopreservation on transcriptome analysis of peripheral blood mononuclear cells

  To investigate the effect of cryopreservation on PBMCs, we conducted an experiment using samples from three healthy donors under four conditions: fresh PBMCs, PBMCs subjected to a single freeze–thaw cycle, PBMCs refrozen in freezing mix, and PBMCs refrozen in TRIzol. This resulted in a total of 12 samples (three replicates per condition). RNA was extracted from all PBMC samples using the Qiagen miRNeasy Mini Kit, followed by polyA RNA sequencing on the Illumina NovaSeq 6000 platform. Blood was collected from one male and two female adult donors. Sequencing yielded high-quality data, with an average of 27.8 million reads per sample and over 94% of bases exceeding a Q30 quality score.

  Study EGAS50000001196

• BRAF_and_MEK_resistant_cell_line_clones

  The Sanger Institute has the largest collection of genetically-characterised cancer cell lines world-wide (we have collected >1000 human cancer cell lines which are being screened against >400 cancer therapeutics (http://www.sanger.ac.uk/genetics/CGP/translation). These lines have been characterized to the level of gene copy number, gene expression and cancer gene mutation sequence data. This has enabled us to select melanoma lines with varying BRAF mutational status and that show sensitivity to a range of BRAF inhibitors. Sensitive lines are being used to generate resistant clones by serial exposure to increasing concentrations of BRAF and MEK inhibitors and these are being characterised by genome-wide copy number analysis as well as by whole exome sequencing.

  Study EGAS00001000172

• HiDEF-seq single-molecule sequencing of single-strand mismatches and damage

  Our study sought to resolve, with single-molecule fidelity, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detect base substitutions when present in either one or both DNA strands. We also detect cytosine deamination, a common type of DNA damage, with single-molecule fidelity. This study profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.

  Study EGAS50000000318

• Single cell RNA-seq and ATAC-seq of CD4+ T cells from blood and tumor of NSCLC patients

  This dataset contains fastq files for paired blood-tumor scRNA-seq samples from 5 NSCLC patients and paired blood-tumor scATAC-seq samples from 2 NSCLC patients, both sequenced with NovaSeq or Illumina HiSeq - Rapid Run.

  Dataset EGAD50000000424

• Cholangiocarcinoma whole genome sequencing data 12 samples

  This dataset contains whole genome sequencing FASTQ data for 12 cholangiocarcinoma tumor samples, and their matched normal samples. These 12 samples are in addition to 59 samples available in dataset EGAD00001001988, and consist of patients from Thailand, Romania, and Singapore. Paired-end sequencing data was generated by Illumina Hiseq 2000 and 2500, with insert sizes of 170 and 350.

  Dataset EGAD00001003834

• OCCAMS_Oesophageal Cancer Organoids_1

  ***THIS DATA CAN ONLY BE USED FOR NON-COMMERCIAL CANCER RESEARCH*** Sequencing of organoid cell lines derived from oesophageal tumour sections taken from patients diagnosed with primary oesophageal cancer who underwent tumour resection surgery.

  Dataset EGAD00001001889

• Bam files from whole exome sequencing (WES)from multiple laser microdissected regions from tumor and paired biopsies from metastatic lesions.

  In this study we characterized genomic alterations in three bladder cancer patients with metastatic disease courses. Multiple regions were procured by laser microdissection or punctures from primary tumor, lymph node metastases and from distant metastases. Data provided here consist of 35 Bam files for WES (32 Tumors and 2 blood, 1 adjacent normal)

  Dataset EGAD00001002772

• New England-Based Case-Control Study of Ovarian Cancer

  The case-control data provided to dbGaP were collected under NCI grant number CA54419 which had 3 enrollment phases: I (1992-1997), II (1998-2002) and III (2003-2008). Altogether, CA54419 funded 15 years of data and specimen collection, resulting in one of the longest running population based case-control studies of ovarian cancer. The study goal was to examine reproductive factors, lifestyle exposures, and genetic background in relation to ovarian cancer risk. The project recruited cases from Eastern Massachusetts and New Hampshire, and became known as the New England-based Case-Control study (NECC) of ovarian cancer. 3957 ovarian cancer cases diagnosed at ages 18-80 and residing in Eastern Massachusetts and New Hampshire were identified through tumor boards and registries. Of these, 3083 (78%) were eligible and among those eligible, 2203 (71%) were enrolled. After excluding 127 non-epithelial and 35 mixed mesodermal tumors, 2041 cases with epithelial tumors of ovarian, primary peritoneal, and fallopian tube origin, including borderline malignancies were included. On average, cases were interviewed 10 months after their diagnosis. A pathologist reviewed pathology reports and recorded histologic subtype, grade, and stage. Mixed ovarian cancers described as predominantly one type were classified as that type. Undifferentiated, transitional cell tumors, or mixed serous/transitional cell tumors were counted as serous. Other mixed epithelial, malignant Brenner, and unspecified epithelial tumors were classified as other. 2100 controls were identified through random digit dialing (RDD), driver-license lists, and town-resident lists. During the first funding phase from 1992 to 1997, 420 (72%) controls identified through RDD and 102 (51%) through town-resident lists agreed to participate. From 1998 to 2008, only town-resident lists were used to identify potential controls. 4366 controls were identified, of whom 1426 (33%) were ineligible if they had died, moved, or were seriously ill or if they did not have a working telephone, speak English, or have at least one ovary. Of eligible controls, 1362 (46%) declined to participate by phone or via 'opt-out' postcard and 1578 (54%) were enrolled. Controls were frequency matched to cases by 5-year age groups and region of residence. In all phases, after written informed consent, demographic information, reproductive and medical history, and habits were assessed by in-person or telephone interview (in a few instances). All of the questions were framed with respect to a reference date defined as 1 year before the diagnosis date for women in the case group and the date of interview for those in the control group. This study was approved by institutional review boards at Dana Farber Harvard Cancer Center and Dartmouth Medical Center.

  Study phs001034

• Whole-exome sequencing data from breast cancer recurrence, endometrial cancer, and colon tumor samples harboring a rare germline BARD1 variant

  This dataset comprises whole-exome sequencing data from tumor and matched blood samples of a patient with breast cancer recurrence and endometrial cancer carrying a germline BARD1 p.(Gly753Val) variant, as well as from the colon tumor of the proband's father

  Dataset EGAD50000002412

• Indigenous American Genomic Diversity Project (IAGDP).

  Here we present the Indigenous American Genomic Diversity Project (IAGDP), comprising 128 newly generated high-coverage (NGS; ~44X) whole genomes from Indigenous individuals across eight Latin American countries, representing 45 populations and 28 language families. This dataset expands Indigenous representation in genomics, with emphasis on geographically and linguistically diverse populations, particularly from the South American lowlands.

  Dataset EGAD50000002396

• Whole-genome sequencing data of metastatic salivary gland cancer

  This dataset contains whole-genome sequencing data of three patients with metastatic salivary gland cancer who underwent autopsy to harvest tumor biopsies from spatially separated metastatic sites and biopsies from healthy skin as a control. Two patients had the subtype adenoid cystic carcinoma (patients 1 and 4) and one patient had the subtype myoepithelial carcinoma.

  Dataset EGAD50000002056

• Targeted DNA sequencing of TTFields-treated glioblastoma, IDH wildtype

  This dataset contains raw paired-end FASTQ files from targeted DNA sequencing using the TruSight Oncology 500 panel in patients with glioblastoma, IDH wildtype, treated with surgery, standard chemoradiotherapy and Tumor Treating Fields at Charité – Universitätsmedizin Berlin. Tumour samples were collected at first surgery and are linked to pseudonymised clinical and molecular annotations described in the associated EGA study.

  Dataset EGAD50000002117

• Whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients

  This dataset contains whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients. Whole exome sequencing with a minimum coverage of 100x was performed using the Illumina Novaseq6000 platform and the Agilent SureSelect Human All Exon V7 kit.

  Dataset EGAD50000002264

• Total RNA sequencing of fibroblasts from an control individual

  Total RNA sequencing of fibroblasts from an individual with 30-55x GCC repeats in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000922

• Disease recurrence after pathologic response

  In this study we aim to gain insight into the mechanisms of immune evasion after initial pathologic response to neoadjuvant immune checkpoint inhibition in macroscopic stage III melanoma by pooling data of the neoadjuvant OpACIN, OpACIN-neo and PRADO trials. Therefore we analyzed in-depth paired baseline and recurrent tumor samples through a.o. DNA sequencing analyses.

  Dataset EGAD50000000699

• Post Mortem brain data used in paper "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing"

  This dataset contains data used in the paper titled "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing. The data consists of one post mortem sample that was sequenced with direct RNA sequencing form Oxford Nanopore Technologies on a promethION flow cell.

  Dataset EGAD00001009308

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007516

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007515

• He et al. RNA-seq data

  This dataset are the bam files of RNA-seq data from the paper by He et al.

  Dataset EGAD00001007135

• LBC1936 VCF

  LBC1921 and LBC1936 GVCFs called with GATK's HaplotypeCaller were combined and subject to variant quality score recalibration. This VCF contains the subset of samples (n = 1068) from the LBC1936 cohort.

  Dataset EGAD00001005478

• Gene panel sequencing of paired samples from primary and relapsed IDH-wt glioblastomas

  This dataset contains gene panel sequencing data from 43 sample pairs of primary and relapsed IDH-wt glioblastomas. The gene panel covers 50 glioma-associated genes. 14 of the sequenced sample pairs were sequenced with whole genome sequencing also and are accessible under EGAD00001004563.

  Dataset EGAD00001004565

• Molecular Biomarkers of Obesity and Metformin Response in Endometrial Cancer: Analysis of GOG-0286B

  The primary endpoint for the phase 2 study was progression free survival (PFS), and the primary endpoint for the phase 3 study was overall survival (OS). Data from phase 2 were included in the phase 3 analysis. Tissue was collected from patients with endometrial cancer who participated in the study (NCT02065687). The tissue will be analyzed for genetic data and combined with the clinical data to see if some gene variants are associated with longer PFS or OS, particularly on the metformin arm of the study.

  Study phs002934

• Archive growth Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue In this section, we expose the overall volume of data available to download and the different archived file types. EGA Archive growth in size and number of files The below figure represents the EGA archive growth in size (TB) and number of files. EGA Archive Growth per year lineChart('ega-archive-growth', 'https://stats.ega-archive.org/growth/archive', ['Volume (TB)'], ['T']) Archive files The below figure represents on a initial level, the percentage of archived files by data technology. The second level, acessible by clicking in the required extension, displays the number of files by extension archived in the ega archive. Please click over the extension to learn more about the files. EGA Archived Files barChart('ega-archived-files', 'https://stats.ega-archive.org/extensions', false ,'', true)

  Documentation about/statistics/archive

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726

• BIOCLOCK Phenotype Information Dataset

  This dataset contains phenotypic metadata from participants in the BIOCLOCK endurance exercise intervention and epigenetic aging study. It includes intervention status, cardiorespiratory fitness (VO2 max), body composition, estimated leukocyte proportions, and other relevant traits linked to epigenetic aging outcomes.

  Dataset EGAD00001015799

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• The characterization of gene expression pattern of anticancer agent-resistant cancer stem cells using RNA sequencing analysis.

  Slow cycling cancer stem cells persist and contribute to tumor regrowth after chemotherapy.To investigate this mechanism, we developed stemness- and cell cycle-visualized colon cancer organoids from patient tissues, and perfomed comparative transcriptome analysis using sorted rapid cycling stem cells (LGR5+p27-) and slow cycling stem cells (LGR5+p27+). In addition, we analyzed the changes in the gene expression patterns in the slow cycling stem cells and all of tumor cells after chemotherapy (camptothecin) treatment. Gene ontology analysis and gene set enrichment analysis using these transcriptome data revealed cell adhesion signal and YAP siganling pathway were important to maintain the dormancy and resume propagation after chemotherapy. In each experiments, total RNA was extracted from organoids and sequenced with HiSeq X Ten (Illumina).

  Study JGAS000350

• Understanding human fetal pancreas development using subpopulation sorting and RNA sequencing

  To decipher the populations of cells present in the human fetal pancreas and their lineage relationships, we developed strategies to isolate pancreatic progenitors, endocrine progenitors and endocrine cells. Transcriptome analysis of the individual populationsrevealed a large degree of conservation among vertebrates in the drivers of gene expression changes occurring at different steps of differentiation, althoughnotably, sometimes, different members of the same gene family are expressed. The transcriptome analysis establishes a resource to identify novel genes and pathways involved in human pancreas development. Single cell profiling further captured intermediate stages ofdifferentiation and enabled us to decipher the sequence of transcriptional events occurring during human endocrine differentiation. Furthermore, we evaluate how well individual pancreatic cells derived in vitro from human pluripotent stem cells mirror the natural processoccurring in human fetuses. This comparison uncovers a few differences at the progenitor steps, a convergence at the steps of endocrine induction and the current inability to fully resolve endocrine cell subtypes in vitro.

  Study EGAS00001003127

• Pancreatic Cancer Sequencing Initiative OICR

  Pancreatic Cancer Sequencing Initiative for the International Cancer Genome Consortium at the Ontario Institute for Cancer Research.

  Study EGAS00001000395

• FASTQ files of the RNA-Seq data for the study "Genomic landscape of lung adenocarcinoma in East Asians"

  FASTQ files of the RNA-Seq data for both the normal and tumor samples for the study "Genomic landscape of lung adenocarcinoma in East Asians". For raw read count data as well as other metadata, please download from https://src.gisapps.org/OncoSG_public/study/summary?id=GIS031 by clicking the download icon next to the dataset title.

  Dataset EGAD00001004421

• Vitamin-D-Kids Asthma

  The Vitamin D Kids Asthma Study (VDKA) was a 48-week multicenter randomized, double-blinded, placebo-controlled trial of vitamin D3 for severe asthma exacerbations in children 6-16 years old, recruited from February 28, 2016 to September 20, 2019. An ancillary study for nasal sampling was conducted at the Pittsburgh site. Prior to randomization, participants completed questionnaires and underwent collection of nasal samples for gene expression studies. VDKA was approved by the IRBs of all participating institutions, and the ancillary study was approved by the IRB of the University of Pittsburgh. Written parental consent was obtained for participating children, from whom written assent was also obtained.

  Study phs004051

• Whole exome and transcriptome sequencing of BPDCN

  This data set contains whole exome and transcriptome data from 47 case with BPDCN. For exome data, bam files are provided (mapped against GRCh38), for transcriptome raw fastq-files (paired-end data).

  Dataset EGAD00001008692

• WGS of cfDNA in PDAC Breast Cancer and Matched Controls

  This dataset contains WGS data derived from plasma cfDNA. The cohort includes PDAC and breast cancer patients alongside matched controls. These data are intended to support research into ctDNA and genomic fragmentation patterns.

  Dataset EGAD50000002323

• Active-Seq of CRC patients

  This dataset contains 48 fastq files of samples derived from CRC patients, including colorectal cancer tissue, normal adjacent tissue and cfDNA samples, processed with the Illumina platform NovaSeq6000.

  Dataset EGAD50000001746

• Single-cell somatic copy number variants in brain using different amplification methods and reference genomes

  This dataset contains 224 paired fastq files (112 single cells) from the following samples: brains from two Multiple System Atrophy patients and one control, and non-brain controls (fibroblasts, NA12878)

  Dataset EGAD50000000030

• Exome and transcriptome sequencing of CDS and ES tumor samples

  This dataset contains WES and RNASeq data of 31 CDS and ES tumor and control samples. Sequencing was performed on Illumina NovaSeq 6000. The sequencing was performed paired in bulk.

  Dataset EGAD00001015608

• 9 samples variant calling data

  This dataset comprise results of mutect2 variant calling in vcf format on 9 samples of rosette forming brain tumors (5 with paired normal tissue and 4 without). Only variants specific to the tumor where kept to comply with patients consent.

  Dataset EGAD00001009266

• 5hmC enrichment in human monocyte differentiation

  This dataset consists of 5hmC capture-seq data from human monocytes, monocyte-derived dendritic cells. It includes two biological replicates and three time points. Including controls, the dataset comprises 10 samples in total.

  Dataset EGAD00001006603