19469 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 59.17 milliseconds.

• A case of colorectal cancer with ERBB2 c.2264T>C (p.Leu755Ser) mutation

  This data set contains next generation sequencing (NGS) data of two serial tumor samples (primary and a metastasis) from a patient with colorectal cancer showing an ERBB2 c.2264T>C (p.Leu755Ser). NGS was performed using the Illumina TruSeq Amplicon Cancer Panel (TSACP, Illumina) covering 212 amplicons in 48 cancer associated genes on the Illumina MiSeq sequencing platform. The dataset contains two BAM files.

  Dataset EGAD00001002252

• The BNT162b2 mRNA COVID-19 vaccine induces long-term effects on both adaptive and innate immune responses

  This dataset contains bulk RNA sequencing at different timepoints post-BNT162b2 mRNA COVID-19 vaccination. Stimulation experiments were performed at each of the timepoints (RPMI, Influenza, R848 and Influenza stimuli), resulting in 242 libraries distributed over 4 stimulations and 4 timepoints. Libraries were sequenced on the DBNSEQ platform.

  Dataset EGAD00001011042

• CATHeterization GENetics (CATHGEN)

  The CATHGEN biorepository consists of biological samples collected on 9334 sequential consenting individuals undergoing cardiac catheterization at Duke University Medical Center between 2001 and 2010 inclusive. The Institutional Review Board informed consent allowed for 50 mL of blood to be collected from fasting patients through the femoral arterial sheath during the catheterization procedure. Three 7.5 mL EDTA tubes for DNA extraction are stored at -80°C. The Duke Database for Cardiovascular Disease (DDCD) provides the bulk of the clinical data used for analysis. Follow-up includes mortality information gleaned from the National Death Index and Social Security Death Index plus follow-up phone calls and written questionnaires regarding MI, stroke, re-hospitalization, coronary re-vascularization procedures, smoking, exercise, and medication use.

  Study phs000703

• Impact of cryopreservation on transcriptome analysis of peripheral blood mononuclear cells

  To investigate the effect of cryopreservation on PBMCs, we conducted an experiment using samples from three healthy donors under four conditions: fresh PBMCs, PBMCs subjected to a single freeze–thaw cycle, PBMCs refrozen in freezing mix, and PBMCs refrozen in TRIzol. This resulted in a total of 12 samples (three replicates per condition). RNA was extracted from all PBMC samples using the Qiagen miRNeasy Mini Kit, followed by polyA RNA sequencing on the Illumina NovaSeq 6000 platform. Blood was collected from one male and two female adult donors. Sequencing yielded high-quality data, with an average of 27.8 million reads per sample and over 94% of bases exceeding a Q30 quality score.

  Study EGAS50000001196

• HiDEF-seq single-molecule sequencing of single-strand mismatches and damage

  Our study sought to resolve, with single-molecule fidelity, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detect base substitutions when present in either one or both DNA strands. We also detect cytosine deamination, a common type of DNA damage, with single-molecule fidelity. This study profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.

  Study EGAS50000000318

• BRAF_and_MEK_resistant_cell_line_clones

  The Sanger Institute has the largest collection of genetically-characterised cancer cell lines world-wide (we have collected >1000 human cancer cell lines which are being screened against >400 cancer therapeutics (http://www.sanger.ac.uk/genetics/CGP/translation). These lines have been characterized to the level of gene copy number, gene expression and cancer gene mutation sequence data. This has enabled us to select melanoma lines with varying BRAF mutational status and that show sensitivity to a range of BRAF inhibitors. Sensitive lines are being used to generate resistant clones by serial exposure to increasing concentrations of BRAF and MEK inhibitors and these are being characterised by genome-wide copy number analysis as well as by whole exome sequencing.

  Study EGAS00001000172

• Type 1 Diabetes Genetics Consortium (T1DGC): ImmunoChip Study

  The Type 1 Diabetes Genetics Consortium (T1DGC) was formed to address issues of limited sample size and consistency of phenotyping that had limited genetic investigations on risk of type 1 diabetes (T1D). The T1DGC first collected affected sib pair (ASP) families from four geographic networks (Asia-Pacific, Europe, North America, United Kingdom). In addition, T1D cases and controls were ascertained from existing and de novo collections. The T1DGC assembled 2,601 T1D ASP families and 69 Parent-T1D offspring trios, T1D cases from the UK Genetic Resource Investigating Diabetes (UKGRID, N=6,670), and controls from the British 1958 Birth Cohort (B58BC, N=6,523), the UK National Blood Services collection (NBS, N=2,893) and the NIHR Cambridge Biomedical Research Centre BioResource (CBR, N=2,846). All samples included in this series have reported or self-declared European ancestry. All DNA samples were collected after approval from relevant institutional research ethics committees. Genotyping was performed using a custom Illumina Infinium high-density genotyping array, ImmunoChip (Illumina, Inc; CA) according to manufacturer's protocols. The ImmunoChip was designed to densely genotype, using 1000 Genomes and any other available disease specific resequencing data, immune-mediated disease loci identified by common variant GWAS. The ImmunoChip Consortium selected 186 distinct loci containing markers meeting genome wide significance criteria (P<5x10-8) from twelve such diseases (autoimmune thyroid disease, ankylosing spondylitis, Crohn's disease, celiac disease, IgA deficiency, multiple sclerosis, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, T1D and ulcerative colitis). All 1000 Genomes Project pilot phase CEU population variants (Sept 2009 release) within 0.1cM (HapMap3 CEU) recombination blocks around each GWAS region lead marker were submitted for array design. No filtering on correlated variants (linkage disequilibrium) was applied. Additional content included regional resequencing data (submitted by several groups) as well as a small proportion of investigator-specific undisclosed content including intermediate GWAS results. After data cleaning and quality control, a total of 154,939 single nucleotide polymorphisms (SNPs) from 186 loci on ImmunoChip were scored. Case-control and family data were analyzed independently and combined by meta-analysis.

  Study phs000911

• Archive growth Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue In this section, we expose the overall volume of data available to download and the different archived file types. EGA Archive growth in size and number of files The below figure represents the EGA archive growth in size (TB) and number of files. EGA Archive Growth per year lineChart('ega-archive-growth', 'https://stats.ega-archive.org/growth/archive', ['Volume (TB)'], ['T']) Archive files The below figure represents on a initial level, the percentage of archived files by data technology. The second level, acessible by clicking in the required extension, displays the number of files by extension archived in the ega archive. Please click over the extension to learn more about the files. EGA Archived Files barChart('ega-archived-files', 'https://stats.ega-archive.org/extensions', false ,'', true)

  Documentation about/statistics/archive

• Measuring the level of relatedness between NGS datasets

  Sequencing technologies are providing increasingly detailed insight in genetic makeup are paving their way into molecular diagnostics. The field will benefit from rigorous and bias-free measures for the quality of sequence data and for the proper representation of the complexity of the original samples. While current methodologies rely on the availability of a well-characterized reference genome, we propose kMer profiling for alignment-free assessment of the quality, comparability, and complexity of sequencing datasets. We show that kMer detects technical artefacts such as high duplication rates, library chimaeras, and differences in library preparation protocols in whole-genome, whole-exome, and RNA sequencing data. Additionally, it successfully captures the complexity and diversity of microbiomes. Thus, kMer allows for a robust evaluation of the quality and complexity of sequencing data without relying on any prior information and opens the way to a more reliable biological reasoning.

  Study EGAS00001000600

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Whole-exome sequencing data from breast cancer recurrence, endometrial cancer, and colon tumor samples harboring a rare germline BARD1 variant

  This dataset comprises whole-exome sequencing data from tumor and matched blood samples of a patient with breast cancer recurrence and endometrial cancer carrying a germline BARD1 p.(Gly753Val) variant, as well as from the colon tumor of the proband's father

  Dataset EGAD50000002412

• Indigenous American Genomic Diversity Project (IAGDP).

  Here we present the Indigenous American Genomic Diversity Project (IAGDP), comprising 128 newly generated high-coverage (NGS; ~44X) whole genomes from Indigenous individuals across eight Latin American countries, representing 45 populations and 28 language families. This dataset expands Indigenous representation in genomics, with emphasis on geographically and linguistically diverse populations, particularly from the South American lowlands.

  Dataset EGAD50000002396

• Whole-genome sequencing data of metastatic salivary gland cancer

  This dataset contains whole-genome sequencing data of three patients with metastatic salivary gland cancer who underwent autopsy to harvest tumor biopsies from spatially separated metastatic sites and biopsies from healthy skin as a control. Two patients had the subtype adenoid cystic carcinoma (patients 1 and 4) and one patient had the subtype myoepithelial carcinoma.

  Dataset EGAD50000002056

• Targeted DNA sequencing of TTFields-treated glioblastoma, IDH wildtype

  This dataset contains raw paired-end FASTQ files from targeted DNA sequencing using the TruSight Oncology 500 panel in patients with glioblastoma, IDH wildtype, treated with surgery, standard chemoradiotherapy and Tumor Treating Fields at Charité – Universitätsmedizin Berlin. Tumour samples were collected at first surgery and are linked to pseudonymised clinical and molecular annotations described in the associated EGA study.

  Dataset EGAD50000002117

• Whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients

  This dataset contains whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients. Whole exome sequencing with a minimum coverage of 100x was performed using the Illumina Novaseq6000 platform and the Agilent SureSelect Human All Exon V7 kit.

  Dataset EGAD50000002264

• Total RNA sequencing of fibroblasts from an control individual

  Total RNA sequencing of fibroblasts from an individual with 30-55x GCC repeats in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000922

• Disease recurrence after pathologic response

  In this study we aim to gain insight into the mechanisms of immune evasion after initial pathologic response to neoadjuvant immune checkpoint inhibition in macroscopic stage III melanoma by pooling data of the neoadjuvant OpACIN, OpACIN-neo and PRADO trials. Therefore we analyzed in-depth paired baseline and recurrent tumor samples through a.o. DNA sequencing analyses.

  Dataset EGAD50000000699

• Gene panel sequencing of paired samples from primary and relapsed IDH-wt glioblastomas

  This dataset contains gene panel sequencing data from 43 sample pairs of primary and relapsed IDH-wt glioblastomas. The gene panel covers 50 glioma-associated genes. 14 of the sequenced sample pairs were sequenced with whole genome sequencing also and are accessible under EGAD00001004563.

  Dataset EGAD00001004565

• LBC1936 VCF

  LBC1921 and LBC1936 GVCFs called with GATK's HaplotypeCaller were combined and subject to variant quality score recalibration. This VCF contains the subset of samples (n = 1068) from the LBC1936 cohort.

  Dataset EGAD00001005478

• He et al. RNA-seq data

  This dataset are the bam files of RNA-seq data from the paper by He et al.

  Dataset EGAD00001007135