11932 results for "cancer rna-seq"

in 19.62 milliseconds.

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• High-Throughput RNA Isoform Sequencing using Programmable cDNA Concatenation

  MAS-ISO-seq is a novel technique for programmably concatenating cDNAs into single molecules for optimal long-read sequencing. In practice, this boosts throughput >15 fold to nearly 40 million cDNA reads per run on the PacBio Sequel IIe sequencer. We have validated this method via application to synthetic RNA isoforms and single-cell sequencing of tumor-infiltrating T cells. Results demonstrated a >30 fold boosted discovery of differentially spliced genes and robust cell clustering, as well as canonical PTPRC splicing patterns across T cell subpopulations and the concerted expression of the associated hnRNPLL splicing factor.

  Study phs003200

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)

  Systemic pan-tumor analyses may reveal the significance of common features implicated in cancer immunogenicity and patient survival. Here, we provide a comprehensive multi-omics data set for 32 patients across 25 tumor types for proteogenomic-based discovery of neoantigens. By using an optimized computational approach, we discover a large number of tumor-specific and tumor-associated antigens. To create a pipeline for the identification of neoantigens in our cohort, we combine DNA and RNA sequencing with MS-based immunopeptidomics of tumor specimens, followed by the assessment of their immunogenicity and an in-depth validation process. We detect a broad variety of non-canonical HLA-binding peptides in the majority of patients demonstrating partially immunogenicity. Our validation process allows for the selection of 32 potential neoantigen candidates. The majority of neoantigen candidates originates from variants identified in the RNA data set, illustrating the relevance of RNA as a still understudied source of cancer antigens. This study underlines the importance of RNA-centered variant detection for the identification of shared biomarkers and potentially relevant neoantigen candidates.

  Study EGAS00001006706

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• FOXM1 is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer that is detectable using metabolic imaging (RNA-seq data)

  PIK3CA, encoding the PI3Kα isoform, is the most frequently mutated oncogene in estrogen receptor-positive breast cancer. Isoform-selective PI3K inhibitors are used clinically but intrinsic and acquired resistance limits their utility. Improved selection of patients that will benefit from these drugs requires novel predictive biomarkers. We show here that persistent FOXM1 expression following drug treatment is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer. Since the transcription factor drives expression of lactate dehydrogenase (LDH) but not hexokinase 2 (HK-II), changes in FOXM1 expression can be detected using magnetic resonance imaging of LDH-catalyzed hyperpolarized 13C label exchange between pyruvate and lactate but not by PET measurements of HK-II-mediated trapping of the glucose analog 2-deoxy-2-[18F]fluorodeoxyglucose.

  Study EGAS00001004452

• Targeted gene fusion sequencing (Fus-seq) in mesothelioma

  This is a small pilot data set to test the feasibility of cDNA exomes across 1200 cancer cell line panel. cDNA exomes or Fus-seq is further explained in this studies Abstract.

  Dataset EGAD00001000361

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Multi-Modal Single-Cell, Spatial, and Genomic Analyses of Human Non-Small Cell Lung Cancer Brain Metastases

  We performed single nuclei RNA-sequencing (snRNA-seq) with matched T cell receptor sequencing (TCR-seq), and pool matched low pass whole genome sequencing (WGS) of 12 treatment-naive non-small cell lung cancer (NSCLC) primary tumors (PTs) and 31 treatment-naive NSCLC brain metastases (BMs). In total, we recovered 277,206 cell transcriptomes in 43 samples. Single-nuclei suspension from frozen NSCLC metastases were generated using methods published in Slyper et al. (Nature Medicine, 2020, PMID:32405060) with modifications. The tissue was first cut in 20 µm sections using a cryostat and stored on dry ice until the next step. Then the tissue was put on wet ice and washed once with 5 ml PBS to remove OCT. After this step nuclei were extracted by vigorous pipetting in salt-tris buffer with Tween-20 (TST) followed by a high-volume wash in salt-tris buffer (ST). Nuclei were counted and 10,000-14,000 and were loaded using a Chromium controller (10X genomics) and Chromium Single Cell 5' Reagents (V1.1 and V2). Complementary DNA libraries were generated according to manufacturer's instructions, with the modification of one additional cycle of amplification. Matched single nuclei T cell receptor (snTCR) sequencing libraries were prepared from amplified cDNA libraries using either Chromium Single Cell V(D)J Enrichment Kit for human T cells Reagent Kit, v1.1, or single cell human TCR amplification kit. Final snTCR sequencing libraries were prepared using Single Index Kit T Set A for V1.1 libraries or Library construction kit and Dual Index Kit TT set A for V2 libraries. Sequencing libraries were quantified using Tapestation D5000 reagents and a 2200 TapeStation and pooled for sequencing. Pool matched low pass whole-genome sequencing (lp-WGS) was performed in addition to snRNA-seq to improve the identification of the malignant and non-malignant cell compartments. Nuclei from snRNA-seq sample preparations were collected by centrifugation (500g, 5 min), snap frozen after removing excess ST buffer, and stored at -200C until further processing. If insufficient nuclei (0C for 9 minutes. Adapters were not diluted, and the optional PCR (5 cycles) and cleanup were performed. After library cleanup with AMPure beads (Beckman Coulter, Brea, CA), libraries were quantified with Tapestation D5000 HS tapes (Agilent) and stored at -200C until sequencing.Using multiplexed immunofluorescence in an independent cohort of treatment-naïve pairs of primary tumors and brain metastases from the same patients with NSCLC, we validated genomic and tumor-microenvironmental findings and identified a cancer cell population characterized by neural features that strongly enriched in brain metastases. This comprehensive analysis provides insights into human NSCLC brain metastasis biology and serves as an important resource for additional discovery.

  Study phs003865

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Transcriptome profiling in human lymphoblastoid cell lines derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Study EGAS50000000498

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• Covacta RNAseq counts

  RNA-seq data from PAXgene extracted whole blood of patients enrolled in the COVACTA trial. This dataset includes read counts per gene. Read counts were generated for the Gencode v27 annotation using the summarize Overlaps method from bioC in mode “IntersectionStrict”

  Dataset EGAD00001011164

• Comprehensive molecular phenotyping of ARID1A-deficient gastric cancer reveals pervasive epigenomic reprogramming and therapeutic opportunities

  This dataset includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset.

  Dataset EGAD50000000660

• Multiregion Whole Exome and Smart-Seq3 single cell RNA sequencing of Breast Tumors

  Multiple regions were cut out of each tumor extracted form breast cancer patients and two experiments were run: - Whole exome sequencing on each of the regions plus an adjacent normal tissue sample - Smart-Seq3 Single cell RNA sequencing on EPCAM+ CD45- sorted cells from different tumor regions

  Study EGAS00001006851

• SGCC GASCAD-II dataset

  The GASCAD-II dataset from the Singapore Gastric Cancer Consortium includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset

  Dataset EGAD00001015433

• Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001227

• Fastq data for stranded mRNA-Seq assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for stranded mRNA-Seq assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001402

• ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001235

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• Common Deleterious Germline Variants Shape the Urothelial Cancer Genome

  Our study used whole-exome, whole-genome, and RNA sequencing to analyze samples from primary tumors, locally recurrent or metastatic urothelial tumors collected over time, and matched normal urothelium. We described the molecular landscape of mutational signatures and structural variants in chemotherapy-resistant urothelial cancer.

  Study phs001087

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• A Phase Ib/II Study of Regorafenib and Paclitaxel in Beyond First-line Advanced Esophagogastric Carcinoma (REPEAT)

  Regorafenib showed promising results in gastric cancer. We aimed to assess the tolerability of regorafenib and paclitaxel in advanced esophagogastric cancer (EGC) patients refractory to first-line treatment and explore potential biomarkers.. We performed enzyme-linked immunosorbent assay measurements of galectin-1, RNA sequencing, and shallow wholegenome sequencing of metastatic tumor biopsies for biomarker analyses.

  Study EGAS00001006054

• RaScALL: Rapid (Ra) screening (Sc) of RNA-seq data for prognostically significant genomic alterations in acute lymphoblastic leukaemia (ALL)

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accelerated risk-stratification and therapeutic triage.

  Dataset EGAD00001009087

• Molecular Characterization for Nasopharyngeal Carcinoma (NPC)

  Total RNA was isolated from 50 formalin-fixed paraffin-embedded nasopharyngeal cancer (NPC) specimens using the RecoverAll Total Nucleic Acid Isolation kit (Ambion). Tumor RNA libraries were prepared with 200ng RNA using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold, and sequenced with >80 million 100 bp paired-end reads.

  Dataset EGAD00001009047

• Studying Glioblastoma in a Human Organoid Tumor Transplantation Model

  This study comprises two complementary investigations that leverage innovative human model systems and cutting-edge molecular profiling to dissect glioblastoma (GBM) heterogeneity and tumor-microenvironment interactions. The first study uses a novel Human Organoid Tumor Transplantation (HOTT) model, in which freshly dissociated GBM tumor cells from five patients were transplanted into human embryonic stem cell-derived cortical organoids. This system enables the interrogation of tumor and microenvironment interactions in a human-specific, developmentally relevant context. Using single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA-seq (snRNA-seq), the authors profiled over 216,000 cells, analyzing tumor heterogeneity across multiple media conditions. Ligand-receptor analysis (CellChat), immunofluorescence, and RNAScope were used to validate findings. The study revealed that the HOTT model faithfully recapitulates primary GBM cell types and microenvironmental components, and uncovered a novel bidirectional signaling axis mediated by PTPRZ1 that influences both tumor migration and cell fate in a context-dependent manner. PTPRZ1 is identified to be important for intercellular communication between tumor and microenvironmental cells, while PDGFRB, NOTCH3, HOPX, FAM107A, CLDN5, RGS5, FOXC1, SOX18 are key markers of the neurovascular progenitor that we identify to be a multipotent, restricted progenitor in GBM. Related datasets include the inclusion of immune cells in the HOTT system, termed “iHOTT”. The second study focuses on identifying and characterizing a rare but functionally potent neurovascular progenitor (NVP) population within GBM tumors. By generating a meta-atlas from seven publicly available GBM scRNA-seq datasets, the authors identified a unique tumor-derived cell population co-expressing neural progenitor and vascular markers. This population was validated in situ and in vivo through immunostaining and lineage tracing via DNA barcoding in the HOTT system. Functional knockdown of NVPs in a murine GBM model resulted in reduced cycling cells, altered tumor composition, and increased survival. Clonal analysis showed NVPs have dual potency to give rise to both neuronal and vascular-like tumor cells, contributing significantly to tumor cell diversity. Molecular technologies used across the studies include: Single-cell and single-nucleus RNA sequencing DNA barcoding and clonal lineage tracing (CellTag) Population information: Tumor samples were obtained directly from multiple GBM patients (all IDH1 wild-type, adult), including core and peripheral tumor regions. Human cortical organoids derived from human embryonic stem cells (hESCs) served as the microenvironment in the HOTT model. Principal findings include: HOTT recapitulates the heterogeneity and cell type fidelity of GBM, while enabling the study of tumor–microenvironment signaling. PTPRZ1 has opposing roles in tumor and microenvironment, influencing GBM cell migration and fate via non-catalytic mechanisms. A novel GBM neurovascular progenitor population (NVP) was identified, validated, and shown to contribute clonally to distinct tumor cell types. Elimination of NVPs in vivo reduces tumor aggressiveness and improves survival. Data to be available through dbGaP: Raw and processed single-cell and single-nucleus RNA-seq data (HOTT model and NVP studies) CellTag barcode-labeled scRNA-seq clonal lineage data Associated metadata including patient of origin, experimental condition, and sample annotations.

  Study phs003936

• Notch Signaling and Efficacy PD-1/PD-L1 Blockade in Relapsed Small Cell Lung Cancer

  Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine (NE) cancer that accounts for approximately 15% of all lung cancer, with an annual incidence of more than 34,000 in the United States alone. SCLC is characterized by loss of function of p53 and RB and high tumor mutational burden, which suggests that these tumors could be immunogenic and respond to immune checkpoint blockade (ICB). However, the benefit from ICB in an unselected SCLC population is modest. In this study, we evaluated the genomic features associated with clinical outcomes in relapsed SCLC to gain insight into the underlying mechanisms of ICB response. Exome, RNA and TCR sequencing data from a prospective clinical trial of relapsed SCLC treated with durvalumab and olaparib and RNA-sequencing data for second cohort of relapsed SCLC cohort treated with nivolumab are included.   

  Study phs002176

• Childhood Cancer Data Initiative (CCDI): OncoKids - NGS Panel for Pediatric Malignancies

  This study aimed to systematically collect clinical, registry and genomic data on pediatric cancer patients, and to contribute to the CCDI Pediatric Data Ecosystem. Clinical, treatment and outcome data on 1,039 pediatric cancer patients whose molecular profile was characterized on OncoKids gene panel at Children's Hospital Los Angeles was abstracted and harmonized for submission to the NCI’s Cancer Data Service. The OncoKids panel was designed to detect DNA mutations and amplification in almost 200 oncogenes and tumor suppressor genes, a limited number of pharmacogenomic targets and 1,700 disease-associated gene fusions at the RNA level. The panel encompasses the vast majority of FDA’s relevant pediatric molecular target list, as well as additional genes associated with ultra-rare pediatric tumors. The final data elements included DNA/RNA sequence data, OncoKids test results, clinical data on demographics, diagnosis, comorbidity and adverse events and treatment data.

  Study phs002518

• Ongoing_mutagenesis_RNAseq

  One of the key questions to be explored is whether the biological processes generating specific mutational signatures continue to operate in the human cancer cell lines or simply reflect past mutagenic activity which is no longer operative. To address this question, we have extracted mutational signatures from 1,000 cancer cell lines of diverse cancer types. Several cell lines with mutational signatures of interest were selected, subcloned over a defined period of time and their genomes sequenced. The increased load of the mutations representative of a specific mutational signature within the genome of a subclone when compared to its parental clone was informative of the on-going mutational processes. To further study the recent observation that some of the clones belonging to a same cell line acquired differencet numbers of mutations over a set period of time, their RNA will be subjected to RNA-sequencing to study their differences.

  Study EGAS00001002364