12304 results for "cancer rna-seq"

in 89.68 milliseconds.

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Genetic coupling of enhancer activity and connectivity in gene expression control

  In this study, we investigated whether the genetic effects of eQTLs on enhancer activity and enhancer-promoter contacts (connectivity) are inherently coupled or distinct. To address this, we performed Capture Hi-C targeting ~1100 eQTL loci, along with ATAC-seq and RNA-seq, in monocytes from 34 healthy male donors. Using single-modality and multi-modality Bayesian statistical approaches, we demonstrated that eQTL effects are predominantly shared across enhancer activity, connectivity, and gene expression. However, we also identified a locus where an eQTL disrupts a CTCF binding site at a putative insulator, facilitating contacts between the PCK2 gene promoter and downstream enhancers. To validate these findings, we used 4C-seq to confirm the allelic effects of eQTLs on enhancer-promoter connectivity at the PCK2 locus and another eQTL region associated with THBS1 expression, both of which showed consistent eQTL effects across all three modalities. Additionally, we conducted Hi-C on monocytes from two donors to map reference TADs and performed ChIP-seq to confirm the allelic effects of the PCK2 eQTL on CTCF binding. Together, these data provide comprehensive insights into the genetic coupling of enhancer activity, connectivity, and gene expression.

  Study EGAS50000000756

• SDR-seq_06_BCL

  Multiomic targeted scDNA-scRNA-seq (SDR-seq) of primary B-cell non-Hodgkin lymphomas. Aim is to link genomci variants to gene expression in single cells. Profiled two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample.

  Study EGAS50000000374

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• Whole Exome and RNA sequencing of synchronous female bilateral breast cancers

  Study EGAS00001006910

• RoCK and ROI single-cell transcriptome of one acute lymphoblastic leukemia patient

  Whole-transcriptome single-cell RNA sequencing (scRNA-seq) was performed following the manufacturer’s protocol (BD Rhapsody, BD Biosciences). Targeted enrichment of BCR::ABL1 transcripts was conducted using the RoCK and ROI-seq approach, based on the barcoded bead technology of the BD Rhapsody platform. In the RoCK and ROI-seq workflow, the template-switch oligonucleotides (TSOs) attached to BD Rhapsody beads were modified with one or multiple capture sequences specific to transcripts of interest, enabling targeted transcript capture during reverse transcription. ROI primers that are added during library preparation to direct amplification and sequencing toward these defined regions of interest (ROIs). Resulting libraries were sequenced on an Illumina sequencer.

  Dataset EGAD50000001976

• BM xenograft TARGET-seq+ single-cell transcriptome sequencing

  Single-cell whole transcriptome sequencing data for 5 xenografted bone marrow samples (4 cases with clonal haematopoiesis and 1 without clonal haematopoiesis). For each sample, mice were treated with two doses of PBS or hTNFa. CD34+ HSPCs and CD34-CD33+ myeloid cells were isolated from xenografted mice, sorted into plates, and TARGET-seq+ was performed to generate plate-based 3' transcriptome data. Additionally, cells from a control primary bone marrow sample (NOC153) were included on each plate. Each library consist of 192 cells sorted into a single plate. FASTQ files are provided; R1 contains cell barcodes and R2 contains the cDNA read. For demultiplexing and pre-processing instructions see: https://github.com/asgerjakobsen/TARGET-seq-plus-RNA.

  Dataset EGAD50000002382

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• scRNA-seq of a 3D human cortical tissue model from human iPSCs exploring 2D versus 3D co-culturing

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model, as well as 2D co-cultures for comparison. Samples include distinct conditions as described in the Study section. The dataset was generated using the BD Rhapsody technology and sequenced paired-end with Illumina NovaSeq2000. Information on the multiplexing of samples is reported in the Analyses section.

  Dataset EGAD50000002021

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• RIP-SeqRaw data

  This dataset contains 15 paired FASTQ files from the PTBP1 project. Sequencing data were generated using bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001723

• Sequencing data of the ampulla and fimbriae of the fallopian tube in pre-menopausal women

  A total of 10 pre-menopausal patients were recruited for this study. Sequencing of both the fimbriae and ampullary region of the fallopian tubes was performed using 10x Genomics single-cell RNA-seq and ATAC-seq. For one patient, data were sequenced across 4 lanes, while the remaining patients' data were sequenced in 2 lanes each, resulting in a total of 44 sequencing datasets for each platform.

  Dataset EGAD50000000889

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• mRNA-Seq on single human MII oocytes collected from gonadotropin stimulated women

  This dataset contains 11 paired-end FASTQ sequences from mRNA-Seq on single human M-II stage oocytes that were collected from gonadotropin stimulated women undergoing fertility treatments. M-II stage oocytes were collected and flash frozen prior to lysis followed by RNA extraction, full length cDNA preparation and amplification using the Ultra-low-input SMART-Seq2 v4 kit from Takara Clonetech. Further, these cDNA were used to prepare libraries for sequencing according the Nextera XT DNA library preparation kit from Illumina.

  Dataset EGAD00001006863

• Peripheral clonal expansion of T cells (scTCR-seq)

  Single-cell TCR-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005465

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Dysregulation of Naive T Cell Quiescence during Aging

  TEA-seq (novel trimodal single-cell analysis of mRNA transcripts, surface protein epitopes, and chromatin accessibility) was performed on CD3+ T cells isolated from peripheral blood of healthy pediatric (11–13 yrs, n = 8) and older adult (55–65 yrs, n = 8) female donors. Single-cell RNA sequencing (scRNA-seq) was additionally performed on peripheral blood mononuclear cells (PBMCs) from a healthy cohort of 16 pediatric, 16 young adult (25–35 yrs), and 16 older adult donors with equal sex distribution. Using these data, we dissected the compositional and molecular alterations within the T cell compartment across the spectrum of healthy age, showing broad transcriptional and epigenetic alterations within the T cell compartment of older adults compared to children, as well as a novel population of pediatric-specific CD8aa T cells.

  Study phs003400

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• The evolutionary dynamics of human colorectal cancer using single-gland spatial multi-omic profiling of DNA, RNA and chromatin.

  Deciphering the mechanisms of colorectal cancer growth, progression and dissemination in each individual patient.

  Study EGAS00001005230

• NCI Laboratory of Translational Genomics (LTG) Human Pancreas QTL study

  We created a human histologically normal pancreas eQTL resource using 91 fresh frozen tissue samples from patients diagnosed with pancreatic cancer (Mayo Clinic and Memorial Sloan Kettering Cancer Center) or from organ donors without a history of pancreatic cancer (Penn State University) by RNA-Sequencing. Genome wide genotyping was done using blood derived DNA samples or normal derived tissue samples. An average of ~369,4 million reads (paired end, stranded, 101 bp) and 724981 genotypes (per sample) were generated.

  Study phs001776

• CITE-seq of early breast cancer

  CITE-seq of early breast cancer samples.

  Dataset EGAD00001007058

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Single-cell RNA sequencing of human omental tissue in benign and metastatic ovarian cancer

  To elucidate the cellular and molecular mechanisms underlying omental homeostasis and its transformation during ovarian cancer metastasis, a human omental cell atlas was generated encompassing both benign and metastatic conditions. Single-cell RNA sequencing was performed on freshly dissociated omental tissue samples from patients with newly diagnosed benign and malignant disease. Samples collected during diagnostic surgery covered distinct anatomical regions, enabling comparison between non-metastasized omentum and sites along the metastatic gradient, including distant, peritumoral, and tumor core areas.

  Study EGAS50000001465

• Chip-exo and Chip-nexus for five TFs in three colorectal cancer cell lines

  Chip-exo and Chip-nexus for FOXA1, HNF4A, KLF5, MYC, and TCF7L2 in colorectal cancer cell lines LoVo, GP5D, COLO320DM

  Dataset EGAD00001004099

• Long-read single-cell RNA-seq in COVID-19

  We report the first application of long-read single-cell RNA sequencing on nasopharyngeal swabs from COVID-19 patients and healthy controls to resolve transcript-level changes across cell types. Samples were collected from three patients with moderate COVID-19, six patients with critical COVID-19, and three healthy controls. Single-cell libraries were generated using the 10x Genomics Chromium 3' protocol, producing unfragmented cDNA. Libraries were sequenced on the Oxford Nanopore Technologies PromethION platform. Basecalling was performed with Guppy (v1.6), generating a single FASTQ file per sample.

  Dataset EGAD50000001836

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• Integrated analysis of whole genome and RNA sequencing in 22 HBV-associated HCCs

  RIKEN collection WGS and RNA-seq reads for 66 HBV-associated HCC and matched blood or liver samples from 22 donors.

  Dataset EGAD00001001035

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• RNA-seq bulk

  This dataset gather all RNA-sequencing data in MM.1S cell line in control and Dex condition; both in 3 biological replicates

  Dataset EGAD00001011137

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Integrative genomic study of CML patients

  This dataset contains WES and RNA-Seq fastq files for 65 CML patient samples at various stages of disease progression.

  Dataset EGAD00001004179

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• CPM table for OAK (GO28915)

  This dataset contains counts per million for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008629

• CPM table for POPLAR (GO28953)

  This dataset contains counts per million for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008631

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794