Search Results - EGA European Genome-Phenome Archive

Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

Study phs004044

Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

Dataset EGAD00001010179

Kidney_tumour_DNA

This is a bulk DNA and RNA sequencing study of human renal tumours

Study EGAS00001002486

Somatic L1 retrotransposition dynamics in high-grade serous ovarian cancer

Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from same patient were utilised to understand L1-mediated intrapatient heterogeneity.

Study EGAS50000001198

ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001231

ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001230

Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001403

Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001408

ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001233

Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001409

ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001229

ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001232

Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001405

ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001234

Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001406

Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001404

Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001407

March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

Dataset EGAD00001001959

RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

Dataset EGAD50000001614

Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

Dataset EGAD50000001664

NeoRhea Bulk RNA and Single nuclei RNA & ATAC

The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

Study EGAS50000001403

Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

Study EGAS00001002185

Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

Dataset EGAD00001009815

Single cell analysis reveals new evolutionary complexity in uveal melanoma

Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

Study phs001861

'KOREAN' never-smoker female adenocarcinoma RNA-seq

Multi-layered genomic studies such as the TCGA project have greatly advanced our understanding on molecular pathogenesis of lung cancer. For Asian nonsmoker patients, however, majority of studies have been limited to mutational analyses, emphasizing ethnic differences in driver mutations (e.g. more frequent EGFR mutations and ALK fusions). In essence, a comprehensive multi-layered characterization that could lead to molecular etiology and patient stratification scheme to be translated into clinical applications for this patient group is still missing. Here we report molecular profiling of tumor and matched normal tissues from 114 non-small-cell lung adenocarcinoma patients using whole exome sequencing, transcriptome sequencing, and array comparative genomic hybridization (CGH).

Study EGAS00001003789

Chip-exo and Chip-nexus for five TFs in three colorectal cancer cell lines

Chip-exo and Chip-nexus for FOXA1, HNF4A, KLF5, MYC, and TCF7L2 in colorectal cancer cell lines LoVo, GP5D, COLO320DM

Dataset EGAD00001004099

Study of biomarkers implicated in radio-immunotherapy response in metastatic cancer

RNA sequencing data of tumors from 53 patients with advanced or metastatic cancer

Dataset EGAD50000001644

Neoantigen study samples for prostate cancer

Whole exome sequencing and RNA sequencing data from 30 patients with prostate cancer.

Dataset EGAD00001005713

RNA_TPO3_2023

Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

Dataset EGAD50000000089

The function of LAMP5 in multiple myeloma

This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

Dataset EGAD50000001178

Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

Dataset EGAD50000000718

RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

Dataset EGAD00001008709

scWGS profile, paediatric acute lymphoblastic leukemia ALL40

Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

Dataset EGAD50000001774

Immune single-cell profiling of human chronic inflammatory skin disease

This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

Dataset EGAD00001008624

Gene expression in LPS-stimulated human monocyte-derived macrophages

This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

Dataset EGAD00001007952

Gene expression in human monocyte differentiation

This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

Dataset EGAD00001006604

11750 results for "cancer rna-seq"

in 18.81 milliseconds.