11750 results for "cancer rna-seq"

in 22.88 milliseconds.

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• Dataset for Stromal-induced epithelial-mesenchymal transition induces drug resistance in acute lymphoblastic leukemia

  RNA-seq was performed to compare gene expression profiles between 11 patient adherent ALL samples and nonadherent ALL samples.

  Dataset EGAD00001009056

• 20210729_EGA_BrainMet Saunus et al J Path (2015)

  Exome sequencing on HiSeq platform of 36 brain metastases with matched normal samples, 32 having matched RNA seq. Published Saunus et al J Path, (2015); https://doi.org/10.1002/path.4583

  Dataset EGAD00001007973

• Profiling human first-trimester neurodevelopment using scATAC-seq and multiomics

  116 single cell ATAC runs and 23 single cell multiome (ATAC+RNA) runs on various brain regions during human first-trimester development.

  Dataset EGAD00001011300

• FASTQ files of the small RNA-Seq dataset from the POPS cohort

  Placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater(ThermoFisher). For each biopsy,total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. Total RNA-libraries were prepared from 300-500ng of total placental RNA with the “TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat”(Illumina). Small RNA-libraries were prepared from 150ng of total placental RNA with the “NEBNext Multiplex Small RNA Library Prep Kit for Illumina”(New England Biolabs)and concentrated using the “QIAquick PCR purification kit”(Qiagen). Paired libraries were combined and size selected using the Pippin Prep and 3% Agarose Gel Cassette with marker F (Sage Science),pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and HiSeq4000 instrument.

  Dataset EGAD00001004860

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• PanCancer genome analysis in 5143 Japanese cancer patients

  This study aimed to establish the Japanese Cancer Genome Atlas (JCGA) using data from fresh frozen tumor tissues obtained from 5143 Japanese cancer patients, including those with colorectal cancer (31.6%), lung cancer (16.5%), gastric cancer (10.8%) and other cancers (41.1%). The results are part of a single-center study called ���High-tech Omics-based Patient Evaluation��� or ���Project HOPE��� conducted at the Shizuoka Cancer Center, Japan. All DNA samples and most RNA samples were analyzed using whole-exome sequencing, cancer gene panel sequencing, fusion gene panel sequencing and microarray gene expression profiling.

  Study JGAS000274

• Transfer Learning Associates CAFs with EMT and Inflammation in Tumor Cells in Human Tumors and Organoid Co-Culture in Pancreatic Ductal Adenocarcinoma

  This study examined the transcriptional changes induced by cancer associated fibroblasts (CAFs) in pancreatic ductal adenocarcinoma patient-derived tumor organoids. We hypothesized that cancer associated fibroblasts impacted tumor cell transcription to promote tumorigenic behavior. Using patient-matched cells from 3 patients, we compared the transcriptional profiles of patient-derived organoids in monoculture to patient-derived organoids co-cultured with CAFs. Similarly, we looked at the transcriptional changes in matched patient-derived cancer associated fibroblasts grown in monoculture or co-cultured with patient-derived organoids. With a focus on intercellular crosstalk, we identified crosstalk between cancer associated fibroblasts and patient-derived organoids through VEGFA and NRP1. This was identified by bulk RNA sequencing and examined dynamically in organoid-CAF co-culture. This dbGaP deposit is the bulk RNA sequencing data for these 3 patients.

  Study phs003563

• Personalized Breast Cancer Vaccines Based on Genome Sequencing

  This study is from a phase I clinical trial of neoantigen DNA vaccines in triple negative breast cancer patients with persistent disease following neoadjuvant chemotherapy. The exome and RNA sequences used to identify somatic mutations, predict neoantigens, and design vaccines is within.

  Study phs002787

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000664

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000653

• (h)MeDIP-Seq of high-risk prostate cancer

  high-throughput sequencing of methylated and hydroxymethylated DNA from tumor and non-tumor tissue of patients with high-risk prostate cancer

  Dataset EGAD00001002010

• High-Throughput RNA Isoform Sequencing using Programmable cDNA Concatenation

  MAS-ISO-seq is a novel technique for programmably concatenating cDNAs into single molecules for optimal long-read sequencing. In practice, this boosts throughput >15 fold to nearly 40 million cDNA reads per run on the PacBio Sequel IIe sequencer. We have validated this method via application to synthetic RNA isoforms and single-cell sequencing of tumor-infiltrating T cells. Results demonstrated a >30 fold boosted discovery of differentially spliced genes and robust cell clustering, as well as canonical PTPRC splicing patterns across T cell subpopulations and the concerted expression of the associated hnRNPLL splicing factor.

  Study phs003200

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• Poikiloderma_syndrome_RNAseq

  We will sequence the RNA of lymphoblast samples, transformed with EBV, which have poikiloderma syndrome with mutations in c16orf57. The aim of the experiment is to characterise RNA structural effects in this disease.

  Study EGAS00001000250

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• Studying Glioblastoma in a Human Organoid Tumor Transplantation Model

  This study comprises two complementary investigations that leverage innovative human model systems and cutting-edge molecular profiling to dissect glioblastoma (GBM) heterogeneity and tumor-microenvironment interactions. The first study uses a novel Human Organoid Tumor Transplantation (HOTT) model, in which freshly dissociated GBM tumor cells from five patients were transplanted into human embryonic stem cell-derived cortical organoids. This system enables the interrogation of tumor and microenvironment interactions in a human-specific, developmentally relevant context. Using single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA-seq (snRNA-seq), the authors profiled over 216,000 cells, analyzing tumor heterogeneity across multiple media conditions. Ligand-receptor analysis (CellChat), immunofluorescence, and RNAScope were used to validate findings. The study revealed that the HOTT model faithfully recapitulates primary GBM cell types and microenvironmental components, and uncovered a novel bidirectional signaling axis mediated by PTPRZ1 that influences both tumor migration and cell fate in a context-dependent manner. PTPRZ1 is identified to be important for intercellular communication between tumor and microenvironmental cells, while PDGFRB, NOTCH3, HOPX, FAM107A, CLDN5, RGS5, FOXC1, SOX18 are key markers of the neurovascular progenitor that we identify to be a multipotent, restricted progenitor in GBM. Related datasets include the inclusion of immune cells in the HOTT system, termed “iHOTT”. The second study focuses on identifying and characterizing a rare but functionally potent neurovascular progenitor (NVP) population within GBM tumors. By generating a meta-atlas from seven publicly available GBM scRNA-seq datasets, the authors identified a unique tumor-derived cell population co-expressing neural progenitor and vascular markers. This population was validated in situ and in vivo through immunostaining and lineage tracing via DNA barcoding in the HOTT system. Functional knockdown of NVPs in a murine GBM model resulted in reduced cycling cells, altered tumor composition, and increased survival. Clonal analysis showed NVPs have dual potency to give rise to both neuronal and vascular-like tumor cells, contributing significantly to tumor cell diversity. Molecular technologies used across the studies include: Single-cell and single-nucleus RNA sequencing DNA barcoding and clonal lineage tracing (CellTag) Population information: Tumor samples were obtained directly from multiple GBM patients (all IDH1 wild-type, adult), including core and peripheral tumor regions. Human cortical organoids derived from human embryonic stem cells (hESCs) served as the microenvironment in the HOTT model. Principal findings include: HOTT recapitulates the heterogeneity and cell type fidelity of GBM, while enabling the study of tumor–microenvironment signaling. PTPRZ1 has opposing roles in tumor and microenvironment, influencing GBM cell migration and fate via non-catalytic mechanisms. A novel GBM neurovascular progenitor population (NVP) was identified, validated, and shown to contribute clonally to distinct tumor cell types. Elimination of NVPs in vivo reduces tumor aggressiveness and improves survival. Data to be available through dbGaP: Raw and processed single-cell and single-nucleus RNA-seq data (HOTT model and NVP studies) CellTag barcode-labeled scRNA-seq clonal lineage data Associated metadata including patient of origin, experimental condition, and sample annotations.

  Study phs003936

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• RaScALL: Rapid (Ra) screening (Sc) of RNA-seq data for prognostically significant genomic alterations in acute lymphoblastic leukaemia (ALL)

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accelerated risk-stratification and therapeutic triage.

  Dataset EGAD00001009087

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• Count table for POPLAR (GO28753)

  This dataset contains counts for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008630

• Count table for OAK (GO28915)

  This dataset contains counts for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008628

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)

  Systemic pan-tumor analyses may reveal the significance of common features implicated in cancer immunogenicity and patient survival. Here, we provide a comprehensive multi-omics data set for 32 patients across 25 tumor types for proteogenomic-based discovery of neoantigens. By using an optimized computational approach, we discover a large number of tumor-specific and tumor-associated antigens. To create a pipeline for the identification of neoantigens in our cohort, we combine DNA and RNA sequencing with MS-based immunopeptidomics of tumor specimens, followed by the assessment of their immunogenicity and an in-depth validation process. We detect a broad variety of non-canonical HLA-binding peptides in the majority of patients demonstrating partially immunogenicity. Our validation process allows for the selection of 32 potential neoantigen candidates. The majority of neoantigen candidates originates from variants identified in the RNA data set, illustrating the relevance of RNA as a still understudied source of cancer antigens. This study underlines the importance of RNA-centered variant detection for the identification of shared biomarkers and potentially relevant neoantigen candidates.

  Study EGAS00001006706

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983