12302 results for "cancer rna-seq"

in 33.10 milliseconds.

• (h)MeDIP-Seq of high-risk prostate cancer

  high-throughput sequencing of methylated and hydroxymethylated DNA from tumor and non-tumor tissue of patients with high-risk prostate cancer

  Dataset EGAD00001002010

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  While cell-free DNA (cfDNA) in liquid biopsies is widely being used and investigated, free circulating RNA (extracellular RNA, exRNA) has the potential to improve therapy response monitoring and cancer detection due to its dynamic nature. A fundamental open question hampering the initiation of large-scale liquid biopsy collections for tumour exRNA analysis is that it remains unclear in which blood subcompartment tumour-derived exRNAs primarily reside. We set out to develop a host-xenograft deconvolution framework, exRNAxeno, with cDNA mapping strategies to either a combined human-mouse reference genome or both species genomes in parallel, that can be applied to exRNA sequencing data from liquid biopsies of human xenograft mouse models, enabling to distinguish (human) tumoural RNA from (murine) host RNA, and as such to specifically analyse tumour-derived exRNA. Subsequently, the preferred exRNAxeno combination pipeline was applied to total exRNA sequencing data from blood platelets and three plasma fractions from a breast cancer patient-derived and neuroblastoma cell line-derived xenograft mouse model. We show that tumoural exRNA concentrations are not determined by plasma platelet levels, while host exRNA concentrations increase with platelet content. Furthermore, a large variability in exRNA levels and gene content across individual mice is observed. In general, the tumoural gene detectability in plasma is correlated with the RNA expression levels in the tumour tissue or cancer cell line. Our results unravel new aspects of tumour-derived exRNA biology in xenograft mouse models.

  Study EGAS00001006582

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• Notch Signaling and Efficacy PD-1/PD-L1 Blockade in Relapsed Small Cell Lung Cancer

  Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine (NE) cancer that accounts for approximately 15% of all lung cancer, with an annual incidence of more than 34,000 in the United States alone. SCLC is characterized by loss of function of p53 and RB and high tumor mutational burden, which suggests that these tumors could be immunogenic and respond to immune checkpoint blockade (ICB). However, the benefit from ICB in an unselected SCLC population is modest. In this study, we evaluated the genomic features associated with clinical outcomes in relapsed SCLC to gain insight into the underlying mechanisms of ICB response. Exome, RNA and TCR sequencing data from a prospective clinical trial of relapsed SCLC treated with durvalumab and olaparib and RNA-sequencing data for second cohort of relapsed SCLC cohort treated with nivolumab are included.   

  Study phs002176

• Childhood Cancer Data Initiative (CCDI): OncoKids - NGS Panel for Pediatric Malignancies

  This study aimed to systematically collect clinical, registry and genomic data on pediatric cancer patients, and to contribute to the CCDI Pediatric Data Ecosystem. Clinical, treatment and outcome data on 1,039 pediatric cancer patients whose molecular profile was characterized on OncoKids gene panel at Children's Hospital Los Angeles was abstracted and harmonized for submission to the NCI’s Cancer Data Service. The OncoKids panel was designed to detect DNA mutations and amplification in almost 200 oncogenes and tumor suppressor genes, a limited number of pharmacogenomic targets and 1,700 disease-associated gene fusions at the RNA level. The panel encompasses the vast majority of FDA’s relevant pediatric molecular target list, as well as additional genes associated with ultra-rare pediatric tumors. The final data elements included DNA/RNA sequence data, OncoKids test results, clinical data on demographics, diagnosis, comorbidity and adverse events and treatment data.

  Study phs002518

• Ongoing_mutagenesis_RNAseq

  One of the key questions to be explored is whether the biological processes generating specific mutational signatures continue to operate in the human cancer cell lines or simply reflect past mutagenic activity which is no longer operative. To address this question, we have extracted mutational signatures from 1,000 cancer cell lines of diverse cancer types. Several cell lines with mutational signatures of interest were selected, subcloned over a defined period of time and their genomes sequenced. The increased load of the mutations representative of a specific mutational signature within the genome of a subclone when compared to its parental clone was informative of the on-going mutational processes. To further study the recent observation that some of the clones belonging to a same cell line acquired differencet numbers of mutations over a set period of time, their RNA will be subjected to RNA-sequencing to study their differences.

  Study EGAS00001002364

• SCLC MeDIP-seq

  Methylation profile of 33 patients with small cell lung cancer (SCLC) for both, tumour and normal lung samples using MeDIP-seq.

  Dataset EGAD50000000724

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• Comprehensive molecular phenotyping of ARID1A-deficient gastric cancer reveals pervasive epigenomic reprogramming and therapeutic opportunities

  This dataset includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset.

  Dataset EGAD50000000660

• Multiregion Whole Exome and Smart-Seq3 single cell RNA sequencing of Breast Tumors

  Multiple regions were cut out of each tumor extracted form breast cancer patients and two experiments were run: - Whole exome sequencing on each of the regions plus an adjacent normal tissue sample - Smart-Seq3 Single cell RNA sequencing on EPCAM+ CD45- sorted cells from different tumor regions

  Study EGAS00001006851

• SGCC GASCAD-II dataset

  The GASCAD-II dataset from the Singapore Gastric Cancer Consortium includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset

  Dataset EGAD00001015433

• RNA-seq on patient-derived, stage II, CRC cell lines

  The gut microbiome is a key player in the immunomodulatory and pro-tumorigenic microenvironment in colorectal cancer (CRC). It is well established that Fusobacterium’s virulence factors are responsible for its pro-tumorigenic properties, however the role of its metabolic cross-talk with the tumor remains unexplored. Here we use in vitro, in vivo, and in silico methods to describe a novel microbe-host interaction keystone: formate. Omics data reveals molecular signatures, linking a metabolically driven CRC phenotype with Fusobacteria. We observed a metabolic shift towards increased F. nucleatum formate secretion in gut-on-chip model co-cultures with patient-derived CRC cells, along with an accelerated cancer glutamine metabolism. We show that high formate levels trigger AhR signaling, increase cancer stemness and cellular invasion. Finally, we observed an expansion of Th17 cells accompanying F. nucleatum-induced tumorigenesis. Moving beyond observational studies, we applied new experimental approaches for gaining ecosystem-level mechanistic understanding of F. nucleatum’s role in cancer pathogenesis.

  Study EGAS00001005948

• Studying Glioblastoma in a Human Organoid Tumor Transplantation Model

  This study comprises two complementary investigations that leverage innovative human model systems and cutting-edge molecular profiling to dissect glioblastoma (GBM) heterogeneity and tumor-microenvironment interactions. The first study uses a novel Human Organoid Tumor Transplantation (HOTT) model, in which freshly dissociated GBM tumor cells from five patients were transplanted into human embryonic stem cell-derived cortical organoids. This system enables the interrogation of tumor and microenvironment interactions in a human-specific, developmentally relevant context. Using single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA-seq (snRNA-seq), the authors profiled over 216,000 cells, analyzing tumor heterogeneity across multiple media conditions. Ligand-receptor analysis (CellChat), immunofluorescence, and RNAScope were used to validate findings. The study revealed that the HOTT model faithfully recapitulates primary GBM cell types and microenvironmental components, and uncovered a novel bidirectional signaling axis mediated by PTPRZ1 that influences both tumor migration and cell fate in a context-dependent manner. PTPRZ1 is identified to be important for intercellular communication between tumor and microenvironmental cells, while PDGFRB, NOTCH3, HOPX, FAM107A, CLDN5, RGS5, FOXC1, SOX18 are key markers of the neurovascular progenitor that we identify to be a multipotent, restricted progenitor in GBM. Related datasets include the inclusion of immune cells in the HOTT system, termed “iHOTT”. The second study focuses on identifying and characterizing a rare but functionally potent neurovascular progenitor (NVP) population within GBM tumors. By generating a meta-atlas from seven publicly available GBM scRNA-seq datasets, the authors identified a unique tumor-derived cell population co-expressing neural progenitor and vascular markers. This population was validated in situ and in vivo through immunostaining and lineage tracing via DNA barcoding in the HOTT system. Functional knockdown of NVPs in a murine GBM model resulted in reduced cycling cells, altered tumor composition, and increased survival. Clonal analysis showed NVPs have dual potency to give rise to both neuronal and vascular-like tumor cells, contributing significantly to tumor cell diversity. Molecular technologies used across the studies include: Single-cell and single-nucleus RNA sequencing DNA barcoding and clonal lineage tracing (CellTag) Population information: Tumor samples were obtained directly from multiple GBM patients (all IDH1 wild-type, adult), including core and peripheral tumor regions. Human cortical organoids derived from human embryonic stem cells (hESCs) served as the microenvironment in the HOTT model. Principal findings include: HOTT recapitulates the heterogeneity and cell type fidelity of GBM, while enabling the study of tumor–microenvironment signaling. PTPRZ1 has opposing roles in tumor and microenvironment, influencing GBM cell migration and fate via non-catalytic mechanisms. A novel GBM neurovascular progenitor population (NVP) was identified, validated, and shown to contribute clonally to distinct tumor cell types. Elimination of NVPs in vivo reduces tumor aggressiveness and improves survival. Data to be available through dbGaP: Raw and processed single-cell and single-nucleus RNA-seq data (HOTT model and NVP studies) CellTag barcode-labeled scRNA-seq clonal lineage data Associated metadata including patient of origin, experimental condition, and sample annotations.

  Study phs003936

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• RNA sequencing of PTCL-NOS

  Study EGAS00001005015

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Common Deleterious Germline Variants Shape the Urothelial Cancer Genome

  Our study used whole-exome, whole-genome, and RNA sequencing to analyze samples from primary tumors, locally recurrent or metastatic urothelial tumors collected over time, and matched normal urothelium. We described the molecular landscape of mutational signatures and structural variants in chemotherapy-resistant urothelial cancer.

  Study phs001087

• Expression profiles of DLL1 positive and negative subpopulations in metastatic colorectal cancer organoids under cetuximab treatment

  Bulk RNA sequencing was performed on metastatic colorectal cancer (mCRC) organoids subjected to cetuximab treatment and FACS-sorted according to DLL1 positivity. This study is part of a larger set of studies focused on investigating cetuximab induced populations in mCRC organoids

  Study EGAS50000001780

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• A Phase Ib/II Study of Regorafenib and Paclitaxel in Beyond First-line Advanced Esophagogastric Carcinoma (REPEAT)

  Regorafenib showed promising results in gastric cancer. We aimed to assess the tolerability of regorafenib and paclitaxel in advanced esophagogastric cancer (EGC) patients refractory to first-line treatment and explore potential biomarkers.. We performed enzyme-linked immunosorbent assay measurements of galectin-1, RNA sequencing, and shallow wholegenome sequencing of metastatic tumor biopsies for biomarker analyses.

  Study EGAS00001006054

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Atezolizumab monotherapy following dCRT indicated a promising cCR rate in patients with unresectable locally advanced esophageal squamous cell carcinoma (EPOC1802)

  The objective is to analyze tumor and normal cell exome sequencing of esophageal cancer patients participating in the Tenergy trial before treatment and RNA sequencing specimens of tumor biopsy specimens at three points before treatment, after radiation chemotherapy, and after atezolizumab administration, in order to search for biomarkers to predict treatment response. Exome sequencing of pretreatment tumor tissue (27 specimens) and normal tissue (27 specimens) from esophageal cancer patients participating in the Tenergy trial, and RNA sequencing of tumor biopsy specimens at three time points before treatment (28 specimens), after radiation chemotherapy (25 specimens) and after atezolizumab administration (25 specimens).

  Study JGAS000708

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• Evaluation of Local Response of Prostate Cancer to Irradiation Using Multiparametric MRI and MR-Guided Biopsies

  The purpose of this study was to determine the rate of local recurrence in patients with intermediate and high risk prostate cancer treated with radiotherapy. In this study, multiparametric MRI was first performed, and biopsy tissue was acquired from cancerous regions detected on MRI. Blood samples were also taken. DNA and RNA were extracted from tissue taken at baseline. DNA was used for whole exome sequencing (WES). RNA was used for gene expression microarray. Each patient then received radiation therapy with androgen deprivation therapy.

  Study phs001821

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• Genome and transcriptome sequencing of cancer of unknown primary tumours

  Genome and transcriptome sequencing of cancer of unknown primary tumours was used to determine yield of clinical biomarkers for a molecular guided trial or for resolving cancer type of origin. This study includes profiling of germline DNA and tumour DNA by whole genome sequencing of tissue and cfDNA biopsies, as well as targeted genome sequencing using two panels, including Comprehensive cancer panel (CCP) and TruSight Oncology 500 (TSO500). This study also includes profiling of tumour RNA by whole transcriptome sequencing.

  Study EGAS50000000452

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Differential Presence of Exons in Cell-Free DNA Reveals Different Patterns in Colorectal Cancer Between Metastatic and Non-Metastatic Patients

  Tumor genotyping during disease follow-up is gaining an increasing interest for monitoring and clinical management in colorectal cancer (CRC). Growing evidences suggest that single biopsies are inefficient for molecular profiling, due to clonal evolution and intratumoral heterogeneity of primary tumors and/or metastasis. Circulating free DNA (cfDNA) has emerged as an alternative source of genetic material that seems to be representative of the continuously changing tumor molecular features. Thus, the so-called 'liquid biopsy' also offers the additional advantages of accessibility and non-invasiveness for the patient. Novel strategies based on next-generation sequencing (NGS) of cfDNA are being currently developed, with most studies focusing on targeted deep sequencing panels of potential clinically actionable genes. Here we describe an alternative approach, consisting of exome-sequencing in cfDNA at a relatively shallower depth to provide a more general overview of the circulating genome. In this study, two groups of colorectal cancer patients, with either disseminated (M) or localized disease (N), were compared using whole-exome sequencing and a RNA-seq bioinformatics analysis pipeline. Thus, a set of 379 exons present at different levels in cfDNA from both groups were identified, giving rise to a completely new concept in this field, termed as 'Differential Presence of Exons'. Differentially present exons (DPEs) were subsequently used for M and N patients clustering and classification, allowing for the design of a predictive algorithm with encouraging preliminary results in a small subset of patients that could not be initially classified attending to the selection criteria (U group, unassignable).

  Study EGAS00001002687

• Molecular Characterization for Nasopharyngeal Carcinoma (NPC)

  Total RNA was isolated from 50 formalin-fixed paraffin-embedded nasopharyngeal cancer (NPC) specimens using the RecoverAll Total Nucleic Acid Isolation kit (Ambion). Tumor RNA libraries were prepared with 200ng RNA using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold, and sequenced with >80 million 100 bp paired-end reads.

  Dataset EGAD00001009047

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• cfDNA methylation dataset for colon cancer

  Enzymatic conversion-based methylation sequencing data (EM-seq) for colon cancer used in the MESA study

  Dataset EGAD50000000075

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Analytical study of protein function and RNA expression involved in predicting treatment efficacy and adverse event development in lung cancer radiotherapy.

  The purpose of this study is to elucidate the functions of DNA repair proteins and RNA expression that are involved in the therapeutic efficacy and adverse events of radiotherapy for lung cancer at our hospital. In particular, this is an exploratory study to identify proteins and RNAs involved in the expression of proteins that are likely to be involved in the prediction of radiotherapy response and adverse events.

  Study JGAS000545

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556