12213 results for "cancer rna-seq"

in 36.05 milliseconds.

• COVID-19 Multiomics Atlas

  We provide a single-nuclei RNA-sequencing (snRNA-seq) dataset derived from four COVID-19 patients, generated using the 10x Chromium Next GEM Single Cell v3.1 kit. For our study, these were integrated with snRNA-seq data with 12 publicly available sc/snRNA-seq datasets, comprising organ donor lung samples (n=89) and COVID-19 lung tissue samples (n=51). Additionally, we provide a spatial transcriptomic dataset characterizing different histopathological stages of diffuse alveolar damage, across a cohort of 33 COVID-19 patients. This was generated using the Nanostring Whole Transcriptome Assay (WTA) with regions of interest (ROIs) sized 400 µm² each. This integrated multi-omics analysis of snRNA-seq, histology, and spatial transcriptomics data, is available for exploration and download via our web portal: https://covid19-multiomicatlas.cellgeni.sanger.ac.uk/.

  Dataset EGAD00001015404

• PCA Atlas Chromium scRNA-seq and demultiplexing support (FASTQs, BAMs, capture-level VCFs and mapping tables)

  This dataset contains Chromium single-cell RNA-seq data and demultiplexing support for the PCA Atlas study EGAS00001008332. Included data objects: - 16 Chromium scRNA-seq FASTQ runs (EGAR accessions) for captures PCa1–PCa16. - 16 aligned BAM analyses (one Cell Ranger possorted_genome_bam.bam per capture). - 16 capture-level genotype VCF analyses derived from the Axiom UK Biobank array, used as demultiplexing panels. - demux_map.csv (EGAZ00001945520): donor–capture–sample mapping for genotype-based demultiplexing. - chromium.csv (EGAZ00001945537): run-level mapping linking captures, EGA samples, runs (EGAR), experiments (EGAX) and BAM analyses. Together these objects provide a complete view of the Chromium scRNA-seq data and the genotype-based demultiplexing support needed to reproduce donor assignment and downstream analyses.See also https://zenodo.org/records/17372603

  Dataset EGAD00001015795

• High-Throughput RNA Isoform Sequencing using Programmable cDNA Concatenation

  MAS-ISO-seq is a novel technique for programmably concatenating cDNAs into single molecules for optimal long-read sequencing. In practice, this boosts throughput >15 fold to nearly 40 million cDNA reads per run on the PacBio Sequel IIe sequencer. We have validated this method via application to synthetic RNA isoforms and single-cell sequencing of tumor-infiltrating T cells. Results demonstrated a >30 fold boosted discovery of differentially spliced genes and robust cell clustering, as well as canonical PTPRC splicing patterns across T cell subpopulations and the concerted expression of the associated hnRNPLL splicing factor.

  Study phs003200

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• Molecular Characterization for Nasopharyngeal Carcinoma (NPC)

  Total RNA was isolated from 50 formalin-fixed paraffin-embedded nasopharyngeal cancer (NPC) specimens using the RecoverAll Total Nucleic Acid Isolation kit (Ambion). Tumor RNA libraries were prepared with 200ng RNA using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold, and sequenced with >80 million 100 bp paired-end reads.

  Dataset EGAD00001009047

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• On-target mutations confer resistance to WRN helicase inhibitors in Microsatellite Unstable Cancer Cells

  This study investigates genetic dependencies and resistance mechanisms to Werner helicase inhibitors (WRNi) in microsatellite-unstable (MSI) cancer models. To define determinants of WRN dependency and acquired resistance, we performed genome-wide CRISPR-Cas9 knockout screens, CRISPR base-editing mutagenesis screens targeting WRN, targeted sequencing of resistance-associated variants, bulk RNA sequencing, and whole-genome sequencing. The datasets deposited in EGA comprise raw sequencing files from CRISPR-Cas9 knockout screens, CRISPR base-editing screens, targeted DNA sequencing, RNA-seq experiments, and whole-genome sequencing of parental and drug-treated cell populations, including models with spontaneously acquired resistance. These data enable investigation of WRN synthetic lethality, genetic modifiers of WRNi response, and genomic alterations emerging under selective pressure.

  Dataset EGAD00001015822

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• cfDNA methylation dataset for colon cancer

  Enzymatic conversion-based methylation sequencing data (EM-seq) for colon cancer used in the MESA study

  Dataset EGAD50000000075

• Analytical study of protein function and RNA expression involved in predicting treatment efficacy and adverse event development in lung cancer radiotherapy.

  The purpose of this study is to elucidate the functions of DNA repair proteins and RNA expression that are involved in the therapeutic efficacy and adverse events of radiotherapy for lung cancer at our hospital. In particular, this is an exploratory study to identify proteins and RNAs involved in the expression of proteins that are likely to be involved in the prediction of radiotherapy response and adverse events.

  Study JGAS000545

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Studying Glioblastoma in a Human Organoid Tumor Transplantation Model

  This study comprises two complementary investigations that leverage innovative human model systems and cutting-edge molecular profiling to dissect glioblastoma (GBM) heterogeneity and tumor-microenvironment interactions. The first study uses a novel Human Organoid Tumor Transplantation (HOTT) model, in which freshly dissociated GBM tumor cells from five patients were transplanted into human embryonic stem cell-derived cortical organoids. This system enables the interrogation of tumor and microenvironment interactions in a human-specific, developmentally relevant context. Using single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA-seq (snRNA-seq), the authors profiled over 216,000 cells, analyzing tumor heterogeneity across multiple media conditions. Ligand-receptor analysis (CellChat), immunofluorescence, and RNAScope were used to validate findings. The study revealed that the HOTT model faithfully recapitulates primary GBM cell types and microenvironmental components, and uncovered a novel bidirectional signaling axis mediated by PTPRZ1 that influences both tumor migration and cell fate in a context-dependent manner. PTPRZ1 is identified to be important for intercellular communication between tumor and microenvironmental cells, while PDGFRB, NOTCH3, HOPX, FAM107A, CLDN5, RGS5, FOXC1, SOX18 are key markers of the neurovascular progenitor that we identify to be a multipotent, restricted progenitor in GBM. Related datasets include the inclusion of immune cells in the HOTT system, termed “iHOTT”. The second study focuses on identifying and characterizing a rare but functionally potent neurovascular progenitor (NVP) population within GBM tumors. By generating a meta-atlas from seven publicly available GBM scRNA-seq datasets, the authors identified a unique tumor-derived cell population co-expressing neural progenitor and vascular markers. This population was validated in situ and in vivo through immunostaining and lineage tracing via DNA barcoding in the HOTT system. Functional knockdown of NVPs in a murine GBM model resulted in reduced cycling cells, altered tumor composition, and increased survival. Clonal analysis showed NVPs have dual potency to give rise to both neuronal and vascular-like tumor cells, contributing significantly to tumor cell diversity. Molecular technologies used across the studies include: Single-cell and single-nucleus RNA sequencing DNA barcoding and clonal lineage tracing (CellTag) Population information: Tumor samples were obtained directly from multiple GBM patients (all IDH1 wild-type, adult), including core and peripheral tumor regions. Human cortical organoids derived from human embryonic stem cells (hESCs) served as the microenvironment in the HOTT model. Principal findings include: HOTT recapitulates the heterogeneity and cell type fidelity of GBM, while enabling the study of tumor–microenvironment signaling. PTPRZ1 has opposing roles in tumor and microenvironment, influencing GBM cell migration and fate via non-catalytic mechanisms. A novel GBM neurovascular progenitor population (NVP) was identified, validated, and shown to contribute clonally to distinct tumor cell types. Elimination of NVPs in vivo reduces tumor aggressiveness and improves survival. Data to be available through dbGaP: Raw and processed single-cell and single-nucleus RNA-seq data (HOTT model and NVP studies) CellTag barcode-labeled scRNA-seq clonal lineage data Associated metadata including patient of origin, experimental condition, and sample annotations.

  Study phs003936

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• BulkRNAseq - Notch Signaling Maintains a Progenitor-Like Subclass of Hepatocellular Carcinoma

  To identify the Notch signaling components expressed in both the human cancer cells and mouse stromal cells that typically comprise PDX tumors, we performed bulk RNA sequencing. Our results demonstrate that a JAG1-NOTCH2 signaling axis within the human cancer cell population drives the Notch dependency in the super-responder models, with NOTCH2 serving as the functionally relevant receptor.

  Study EGAS50000000515

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• CMF_RNA_sequencing

  RNA sequencing will be undertaken to reconstruct rearrangements at level of transcription to determine pathogenomic genomic events in chondromyxoid fibroma

  Study EGAS00001000470

• Differential Presence of Exons in Cell-Free DNA Reveals Different Patterns in Colorectal Cancer Between Metastatic and Non-Metastatic Patients

  Tumor genotyping during disease follow-up is gaining an increasing interest for monitoring and clinical management in colorectal cancer (CRC). Growing evidences suggest that single biopsies are inefficient for molecular profiling, due to clonal evolution and intratumoral heterogeneity of primary tumors and/or metastasis. Circulating free DNA (cfDNA) has emerged as an alternative source of genetic material that seems to be representative of the continuously changing tumor molecular features. Thus, the so-called 'liquid biopsy' also offers the additional advantages of accessibility and non-invasiveness for the patient. Novel strategies based on next-generation sequencing (NGS) of cfDNA are being currently developed, with most studies focusing on targeted deep sequencing panels of potential clinically actionable genes. Here we describe an alternative approach, consisting of exome-sequencing in cfDNA at a relatively shallower depth to provide a more general overview of the circulating genome. In this study, two groups of colorectal cancer patients, with either disseminated (M) or localized disease (N), were compared using whole-exome sequencing and a RNA-seq bioinformatics analysis pipeline. Thus, a set of 379 exons present at different levels in cfDNA from both groups were identified, giving rise to a completely new concept in this field, termed as 'Differential Presence of Exons'. Differentially present exons (DPEs) were subsequently used for M and N patients clustering and classification, allowing for the design of a predictive algorithm with encouraging preliminary results in a small subset of patients that could not be initially classified attending to the selection criteria (U group, unassignable).

  Study EGAS00001002687

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• The Landscape of Antisense Gene Expression in Human Cancers

  High throughput RNA Sequencing has revealed that the human genome is widely transcribed. However, the extent of natural antisense transcription, the molecular mechanisms by which natural antisense transcripts (NATs) might affect their cognate sense genes, and the role of NATs in cancer are less well understood. Here, we use strand-specific paired-end RNA sequencing (ssRNASeq) on a cohort of 376 cancer patients covering 9 tissue types to comprehensively characterize the landscape of antisense expression. Our results reveal that greater than 60% of annotated transcripts have measureable antisense expression and the expression of sense and antisense transcript pairs is in general positively correlated. Furthermore, by studying the expression of sense/antisense pairs across tissues we identify lineage-specific, ubiquitous and cancer-specific antisense loci. Our results raise the possibility that NATs participate in the regulation of well-known tumor suppressors and oncogenes. Finally, this study provides a catalogue of cancer related genes with significant antisense transcription (oncoNAT). This resource will allow researchers to investigate the molecular mechanisms of sense/antisense regulation and further advance our understanding of their role in cancer.

  Study phs000937

• Djerroudi et al., E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulate FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF increase TIL infiltration and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, revealing why and how TILs have a poor prognosis in ILC patients, a mechanism extrapolated to other CDH1-mutated cancer types.

  Study EGAS50000000761

• An integrated molecular study of 20 hepatoblastoma pairs using whole genome sequencing and RNA sequencing

  Hepatoblastoma is an uncommon malignant liver cancer occurring in infants and children. The mutant background of hepatoblastoma has not been fully demonstrated. The aim of this study is to genomically depict the mutational landscape of hepatoblastoma through an integrative analysis of whole genome sequencing and RNA sequencing of 20 hepatoblastomas from Chinese individuals.

  Study EGAS00001002772

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• RNA sequencing of Non-Small Cell Lung Cancer and adjacent normal tissue

  RNA sequencing was performed on 108 NSCLC tumor samples and their paired adjacent normal tissues (n=21) to identify associations with clinical and immune characteristics.

  Study EGAS50000000246

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• DAC for study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer."

  This is Data Access Committee will oversee data sharing for sequence data in the EGA study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer." This dataset includes 116 bam files from whole exome sequencing on the Illumina HiSeq2500, 102 fastq files from RNA sequencing on the Illumina NovaSeq 6000. The samples analyzed include tumor/normal DNA samples and tumor RNA samples from 72 individuals with non-small cell lung cancer treated with pembrolizumab and SBRT or pembrolizumab alone on the NCT02492568 trial.

  Dac EGAC50000000202

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Bladder cancer subtyping study across 4 atezo clinical trials

  Checkpoint inhibitors targeting the PD-1/PD-L1 interaction have revolutionized cancer therapy across many indications. In urothelial carcinoma (UC), several PD-1/PD-L1 inhibitors have been approved for treatment in localized and metastatic disease. While these agents provide durable clinical benefit in a number of patients, the majority do not respond. A better understanding of the molecular mechanisms underlying response and resistance is needed to tailor existing treatments and develop new therapeutics in UC. We profiled tumors from 2803 patients from four late-stage randomized clinical trials evaluating the PD-L1 inhibitor atezolizumab in metastatic UC and muscle-invasive bladder cancer by RNA-seq, a targeted DNA panel, immunohistochemistry, and digital pathology. A machine learning algorithm identified four UC transcriptional subtypes, representing luminal desert, stromal, immune, and basal tumors. Overall survival benefit from atezolizumab over standard-of-care was observed in immune and basal tumors (45% of patients). Digital pathology showed enrichment of human interpretable features in specific molecular subtypes, and a self-supervised approach could classify molecular subtypes from H&E slides with high accuracy, suggesting that machine-based image interpretation could accelerate tumor molecular profiling. Somatic alterations showed limited capacity to identify responders. Finally, mechanisms of benefit with PD-L1 blockade appeared different in immune and basal tumors, with immune tumors benefiting from B/plasma cell enrichment, while basal tumors benefited from granulocyte enrichment. This study represents the largest integration of UC molecular and curated clinical data in randomized clinical trials to date, paving the way for prospective clinical studies tailoring treatment regimens to specific tumor molecular subtypes in UC and other indications.

  Study EGAS50000000497

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556

• Space Associated Stem Cell Hallmarks of Aging in Astronauts

  This study examined the effects of the stress of space, specifically low earth orbit, on hematopoietic stem and progenitor cells (HSPCs) that maintain lifelong hematopoiesis and immune responses. Enriched CD34+ HSPCs were derived from 7 astronauts before, during and after 10 and 21-day ISS missions on the International Space Station. The samples were used as input to whole transcriptome sequencing by bulk RNA-Seq performed at The Scripps Research Institute Next Generation Sequencing Core on Illumina NextSeq 2000 sequencer and single cell RNA-Seq performed at The Salk Institute for Biological Studies on Illumina NovaSeq X Plus sequencer. Subsequent expression, RNA editing, and retrotransposon analyses were performed to assess HSPC and immune subpopulation survival dynamics. Overall, these analyses revealed space-associated stem cell hallmarks of aging (SASHA), including spaceflight dependent alterations in HSPC survival and self-renewal, ADAR1, telomere maintenance, mobilization and cell cycle gene expression, combined with space-induced clonal hematopoietic mutations, APOBEC3C activation and retrotransposon deregulation to warrant countermeasure development to enable long-duration spaceflight. Post-spaceflight analysis revealed increased C-to-T and clonal hematopoiesis-associated mutations, repetitive element and base deaminase deregulation, decreased telomere maintenance gene expression, and decreased self-renewal capacity compared to ground controls. These results demonstrate the space-associated aging effects in HSPCs after month-long exposure to LEO, providing insights into utilizing the LEO environment to model space-accelerated aging and other age-related malignancies.

  Study phs004267