14978 results for "cancer studies using rna-seq"

in 18.39 milliseconds.

• TRACERx 100: metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Study EGAS00001002415

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__head___neck

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute. Non-tumour DNA is also studied for some cancer types. Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005450

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• NHLBI TOPMed: HyperGEN - Genetics of Left Ventricular (LV) Hypertrophy

  The Hypertension Genetic Epidemiology Network Study (HyperGEN) - Genetics of Left Ventricular (LV) Hypertrophy is a familial study aimed to understand genetic risk factors for LV hypertrophy by conducting genetic studies of continuous traits from echocardiography exams. The originating HyperGEN study aimed to understand genetic risk factors for hypertension. Data from detailed clinical exams as well as genotyping data for linkage studies, candidate gene studies and GWAS have been collected and is shared between HyperGEN and the ancillary HyperGEN - Genetics of LV Hypertrophy study.

  Study phs001293

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Genomic Origins and Admixture in Latinos (GOAL)

  The GOAL Study was designed to comprehensively evaluate the genomic architecture of diverse Hispanic/Latino individuals with origins from the Caribbean, Central and South America, and to understand the impact of this diversity on genetic disease studies. Population structure and admixture are key confounders in genome-wide association and medical resequencing studies. In particular, accounting for difference in ancestry among cases and controls, both in terms of genomic and geographic location, is critical for proper analysis and interpretation of studies with multi- and trans-ethnic samples. Genomic studies of Hispanics/Latinos, the largest and fastest growing minority group in the US, reveal that they are a highly genetically heterogeneous admixed group with immense variation among individuals and populations in the proportions of African, European, and Native American ancestry. Knowledge of the underlying complex genetic structure of US Hispanic/Latino and Caribbean populations is, therefore, essential to ensuring robustness of genotype-phenotype associations and understanding the medical relevance of associated variants across diverse populations in the US and throughout the Americas. Furthermore, since much is known about the African and European migrations into the Americas over the past 500 years, population genetic studies of Hispanics/Latinos serve as an excellent model for developing novel algorithms and approaches for characterizing fine-scale genetic structure of admixed populations, in general. This project extends current studies of population genetic structure in US Hispanics/Latinos by densely genotyping parent-offspring triads from individuals (sampled in the US) of Caribbean-descent from six Latin American countries: Puerto Rico, Cuba, Dominican Republic, Haiti, Honduras and Colombia. This study will provide immediate insights and new statistical methods to improve study design and genetic analysis for medical genomic studies in Hispanics/Latinos, other complex admixed groups, and multi- and trans-ethnic studies.

  Study phs000750

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• NHLBI TOPMed: Pulmonary Fibrosis Whole Genome Sequencing

  This is a set of cases diagnosed with idiopathic pulmonary fibrosis, a fatal interstitial lung disease. These cases were included in the TOPMed phase three studies. The planned study will compare these cases to within-TOPMed controls for genome-wide association studies.

  Study phs001607

• Genome-Wide Association Studies of Prematurity and Its Complications (African American)

  Preterm delivery resulting in the birth of a premature infant is a complex problem with a devastating impact on individuals, families and society. The prevalence of preterm birth has increased steadily in developed countries over the last 20 years and more than three million children die of preterm birth worldwide each year. Despite the importance of the problem and its disproportionate occurrence in poor and minority populations, the underlying causes have been difficult to identify. Spontaneous preterm labor has as its suspected triggers infection, stress, poor nutrition and inherited factors. The single best predictor for preterm delivery is a previous preterm birth. Studies of twins and of recurrences within families provide evidence that genetic factors underlie a substantive component of the risk for prematurity. One major challenge in studying genetic factors in prematurity is that the risk case is not truly established. The genetic risk could reside either in the mother and her uterus or in the infant/placenta. Identification of genetic factors in the mother and/or infant could provide insights into identifying relevant environmental covariates that may be more amenable to rapid interventions but difficult to find using standard epidemiology alone. A comprehensive genome-wide association study (GWAS) is the ideal way to identify those genes that would not be suspected based on our current understanding of the biology of parturition. We are using 2200 African American samples with term or preterm labor. A subset of these (~800) are infant samples recruited by the Neonatal Research Network as part of a study on cytokines and infection in extremely low birth weight infants (Schelonka RL, et al., 2011. PMID: 21145756). Therefore, this group consists of infants <1,000 grams with clinical outcome data for the infant allowing study of the genetic contributors for not only preterm birth but also the complications that often accompany preterm birth. The result will enable a better understanding of the biology of parturition and suggest environmental modifications that can prolong gestations to improve neonatal and adult outcomes. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to preterm birth through large-scale genome-wide association studies of African-American cases and controls from multiple sites in the United States. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000353

• WGS of CTCs enriched using high-throughout microfluidic device from entire cancer patient leukopak

  Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2).

  Study EGAS50000000723

• Sequencing of in vitro generated macrophages and T cells

  Monocyte derived macrophages were polarised into M1 or M2 using IFNg+ ILP or IL-4 respectively (n =4) . Pan T cells were cultured with or without IL-2 for 4 days (n=4 - 6). Pan T cells were co-cultured with THP1 tumour cells for 20 hours in the presence or absence of ImmTAC molecules and in the presence or absence of M2 macrophages. Sorted T cells and macrophage populations prior and post co-culture were analysed by bulk RNA sequencing (60 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000837

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• Mapping genetic effects on cell type-specific chromatin accessibility using single nucleus ATAC-seq

  Gene regulation is highly cell type-specific and understanding the function of non-coding genetic variants associated with complex traits requires molecular phenotyping at cell type resolution. In this study we performed single nucleus ATAC-seq (snATAC-seq) and genotyping in peripheral blood mononuclear cells from 13 individuals. We mapped chromatin accessibility QTLs (caQTLs) in each immune cell type and sub-type in a subset of 10 samples of European genetic ancestry.

  Study EGAS00001006184

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• scRNA-seq of HSPC treated with gemcitabine and carboplatin

  4 samples of 2000000 HSPCs in 2 ml media each were then prepared and treated for 24 hours: carboplatin-high: 150 µg/ml carboplatin carboplatin-low: 18.75 µg/ml carboplatin gemcitabine: 25 ng/ml gemcitabine control: no drug Single-cells were subsequently extracted using the ddSEQ™ Single-Cell Isolator (Bio-Rad) and later sequenced using the SureCell™ Whole Transcriptome Analysis 3' Library Prep Kit (Illumina) on the NextSeq 500 System (Illumina) using the NextSeq 500/550 High Output Kit v2.5 150 Cycles (Illumina) all following the manufacturer's instructions. The raw FASTQ-files are available as read 1 and read 2 files from 4 lanes for each sample giving a total of 16 FASTQ-files. The FASTQ-files were also processed following the ddSeeker (Romagnoli, D., et al., BMC Genomics 2018, doi:10.1186/s12864-018-5249-x) and Drop-seq (Macosko, E.Z., et al., Cell 2015, doi:10.1016/j.cell.2015.05.002) protocols for processing scRNA-seq data to yield the final digital gene expression (dge) for each cell of each sample. This has resulted in one dge text file and one dge summary text file per sample. These 8 text-files with dge data are found in the zip-compressed analysis data-file.

  Dataset EGAD00001006080

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Multi-omic analysis of the tumor microenvironment shows clinical correlations in Ph1 study of atezolizumab +/- SoC in MM

  Multiple myeloma (MM) remains incurable, and treatment of relapsed/refractory (R/R) disease is challenging. There is an unmet need for more targeted therapies in this setting; deep cellular and molecular phenotyping of the tumor and microenvironment in MM could help guide such therapies. This phase 1b study (NCT02431208) evaluated the safety and efficacy of the anti-programmed death-ligand 1 monoclonal antibody atezolizumab (Atezo) alone or in combination with the standard of care (SoC) treatments lenalidomide (Len) or pomalidomide (Pom) and/or daratumumab (Dara) in patients with R/R MM. Study endpoints included incidence of adverse events (AEs) and overall response rate (ORR). A novel unsupervised integrative multi-omic analysis was performed using RNA sequencing, mass cytometry immunophenotyping, and proteomic profiling of baseline and on-treatment bone marrow samples from patients receiving Atezo monotherapy or Atezo+Dara. A similarity network fusion (SNF) algorithm was applied to preprocessed data. Eighty-five patients were enrolled. Treatment-emergent deaths occurred in 2 patients; both deaths were considered unrelated to study treatment. ORRs ranged from 11.1% (Atezo+Len cohorts, n=18) to 83.3% (Atezo+Dara+Pom cohort, n=6). High-dimensional multi-omic profiling of the tumor microenvironment and integrative SNF analysis revealed novel correlations between cellular and molecular features of the tumor and immune microenvironment, patient selection criteria, and clinical outcome. Atezo monotherapy and SoC combinations were safe in this patient population and demonstrated some evidence of clinical efficacy. Integrative analysis of high dimensional genomics and immune data identified novel clinical correlations that may inform patient selection criteria and outcome assessment in future immunotherapy studies for myeloma.

  Study EGAS00001007286

• Pediatric Investigation for Genetic Factors Linked with Renal Progression (PediGFR)

  The Pediatric Investigation for Genetic Factors Associated with Renal Progression (PediGFR) (RO1-DK082394) is an international collaborative study among three large prospective cohort studies of children with chronic kidney disease. The participating parent cohort studies are the Chronic Kidney Disease in Children (CKiD), the Effect of Strict Blood Pressure Control and ACE Inhibition on CRF Progression in Pediatric Patients (ESCAPE), and the Cardiovascular Comorbidity in Children with Chronic Kidney Disease (4C) study. In these cohorts, pediatric subjects with CKD have been prospectively followed with standardized measurements for renal progression. The dbGaP data upload will utilize the structure of sub-studies to include the genotype and baseline phenotype for the three cohorts, as well as the RBC trait and anemia data for a sub-study under PI Susan Furth: Role of Genetic Variation in the Anemia of Chronic Kidney Disease (K24DK078737). In brief PediGFR is a prospective study of children with chronic kidney disease (CKD) to determine genetic factors associated with kidney function measured by the estimated glomerular filtration rate (eGFR) by Schwartz equation. The PediGFR_v2 Cohort is utilized in the following dbGaP sub-studies. To view genotypes, other molecular data, and derived variables collected in these sub-studies, please click on the following sub-studies below or in the "Sub-studies" box located on the right hand side of this top-level study page phs000842 PediGFR_v2 Cohort. phs000843 4C phs000650 CKiD phs000844 ESCAPE

  Study phs000842