21033 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 37.03 milliseconds.

• Whole Genome Sequencing of Head and Neck Angiosarcoma

  This dataset contains 55 Whole Genome Sequencing of the study titled Spatial transcriptomics reveal topological immune landscapes of Asian head and neck angiosarcoma.

  Dataset EGAD00001010140

• Prostate cancer m6A epitranscriptome

  Using meRIP-sequencing, we profiled N-6 methyladenosine (m6A) in a cohort of 148 primary prostate cancer samples as part of the Canadian Prostate Cancer Genome Network project (CPC-GENE). Paired-end sequencing of 150 bp reads were mapped to GRCh38.p13 using annotations from gencode.v34.chr_patch_hapl_scaff.annotation.gtf. Peaks were called using MeTPeak, joint peaks were identified and IP reads were quantitated, normalized and adjusted using Input reads to obtain estimates of m6A abundance.

  Dataset EGAD00001009869

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010315

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010318

• ATAC-seq and RNA-seq datasets of CD14+ monocytes from healthy donors

  This dataset consists of functional genomic data from 6 healthy donors taken from CD14+ monocytes upon different immune stimulations. It contains 150 paired end fastq files consisting of 30 total RNA-seq samples across 4 runs and 30 ATAC-seq samples. The samples were sequenced on Illumina HiSeq4000 platform.

  Dataset EGAD00001011113

• Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient

  Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient,generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001015583

• Single-cell analysis of matched FFPE and frozen tissue samples reveals comparable resolution of intratumoural heterogeneity

  Testing the differences between FFPE and fresh frozen derived single cell results.

  Dataset EGAD00001015781

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• RNA-seq data from primary AML samples with t(3;8)

  RNA-seq was generated to investigate differences in gene expression between t(3;8) AML and other primary AMLs. Briefly, sample libraries were prepared using 500 ng of input RNA according to the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche) using Unique Dual Index adapters (Integrated DNA Technologies, Inc.). Amplified sample libraries were paired-end sequenced (2x100 bp) on the Novaseq 6000 platform (Illumina

  Dataset EGAD00001006819

• VRK3 depletion in Pontine Diffuse Midline Glioma DMG-K27 altered cells

  In order to investigate possible mechanisms underlying the phenotype of cell fitness decline observed following decrease of VRK3 in pontine DMG-K27 altered cells 7, we examined differences in global gene expression. RNA-seq was performed 44h and 60h post-transduction with two distinct shRNAs targeting VRK3 to be able to evaluate the early impact of VRK3 knock-down (KD) in four independent in vitro models of DMG

  Dataset EGAD00001010097

• Neo-CheckRay

  Patients with oestrogen receptor-positive (ER+), HER2-negative, early breast cancer (BC) have low pathological complete response (pCR) rates following neoadjuvant chemotherapy (NACT). Phase 3 trials showed that adding an anti-PD-1 immune checkpoint inhibitor (ICI) improves pCR, but there was less benefit in the PD-L1 negative tumours, characterised by an immune “cold” tumour microenvironment (TME). We hypothesized that immune-modulating stereotactic body radiation therapy (iSBRT) could enhance treatment response by reprogramming the immune deprived TME in early ER+/HER2- BCA. We conducted a phase 2, randomized, multicentre trial evaluating NACT plus iSBRT, with or without durvalumab (anti-PD-L1) and with or without oleclumab (anti-CD73) in 147 patients with high-risk, early, ER+/HER2- breast cancer patients.

  Study EGAS50000001777

• High-resolution analysis for urinary DNA jagged ends

  High-resolution analysis for urinary DNA jagged ends

  Study EGAS00001005603

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - RNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009813

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• DAC Recurrent resistance mutations to lirafugratinib delineate treatment sequences for FGFR2-driven tumors

  DAC for Recurrent resistance mutations to lirafugratinib delineate treatment sequences for FGFR2-driven tumors

  Dac EGAC50000000699

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Exome and RNA sequencing of pancreatic cancer biopsies and PDX models

  Pancreatic cancer biopsies and matching normal controls from 10 patients were exome sequenced. The same biopsies and PDX models derived from these were also subject to RNA sequencing.

  Dataset EGAD00001008113

• Gut metagenome from Estonian Microbiome Cohort

  Stool samples were collected from 2,509 Estonian Biobank participants. The shotgun metagenomic paired-end sequencing was performed by Novogene Bioinformatics Technology Co., Ltd. using the Illumina NovaSeq6000 platform, resulting in 4.62 ± 0.44 Gb of data per sample (insert size, 350 bp; read length, 2 × 250 bp). A total of 2,513 samples belonging to 2,509 individuals were sequenced, including 4 biological replicates from one individual. First, the reads were trimmed for quality and adapter sequences. The host reads that aligned to the human genome were removed using SOAP2.21 (parameters: -s 135 -l 30 -v 7 -m 200 -x 400).

  Dataset EGAD00001008448

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  Study EGAS00001000753

• CHILD Study Dataset

  This data set contains the CRAM files for the samples in the CHILD cohort, sequenced on the Illumina HiSeq X platform.

  Dataset EGAD00001009710

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726

• 200PT : CNA vcf files

  200PT : CNA vcf files. Copy Number Abberation calls generated using TITAN and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004073

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• Her2 BC WGS dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001334

• BAM files

  DNA sequencing reads of human adult stem cell cultures from liver, colon and small intestine. Including biopsy or blood samples of the donors.

  Dataset EGAD00001001900

• An Interim Report on the Investigator-initiated Phase 2 Study of Pembrolizumab Immunological Response Evaluation (INSPIRE)

  Whole exome sequencing BAM files of 50 metastatic solid tumour and matched blood germline DNA prior to pembrolizumab treatment.

  Dataset EGAD00001004873

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• scRNAseq data of primary and metastatic melanoma samples

  Paired-end 10x single-cell RNA sequencing data from 13 melanoma samples. Sequencing was performed on the Illumina NovaSeq 6000 using 10xGenomics Chromium Next GEM Single-Cell 5 Reagent Kits v2.

  Dataset EGAD50000000665

• mt-scATAC-seq data and analysis

  Data and analysis of mt-scATAC-seq assay of Lin- CD34+ sorted live cells from bone marrow tissue of 4 patients with AML (before treatment with decitabine). Data files are paired-end reads in FASTQ format from the NextSeq 2000 sequencer. Analysis files are outputs from Cellranger ATAC: .h5 peak matrix file, atac_fragments.tsv.gz file and its index.

  Dataset EGAD50000001375

• RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells

  RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells. RNAseq was performed using 200 ng of total RNA by GATC Biotech. Directional libraries were performed after mRNA selection by polyA selection using UTP method. RNA-seq libraries were sequenced on HiSeq2500 Illumina machine using 100bp paired-end reads. Reads alignment was performed using the STAR aligner (version 2.4.0f1) and human genome hg19 as reference.

  Dataset EGAD00001007813

• Genome and transcriptome sequence data from a metastatic high-grade adenocarcinoma of the fallopian tubes patient

  Genome and transcriptome sequence data from a metastatic high-grade adenocarcinoma of the fallopian tubes patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004709