21033 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 35.13 milliseconds.

• Next Generation Sequencing Characterization of Tregs in Human Peripheral Blood during Autoimmunity

  Tregs were sorted as CD4+CD25+CD127- cells from peripheral blood of 14 healthy individuals, 8 patients with mild/severe rheumatoid arthritis, 1 patient with systemic lupus erythematosus/rheumatoid arthritis, 2 patients with ulcerative colitis and 2 patients with Chrohn's disease. RNA was extracted and polyA libraries were prepared using the Illumina Truseq sample preparation kit v.2. Single-end 75bp sequencing was performed on NextSeq500.

  Dataset EGAD00001005446

• Chromatin accessibility analysis of hepatocyte-like cell in vitro differentiation from iPSC in comparison to primary human hepatocytes

  Fastq files of ATAC-seq data of induced pluripotent stem cells (iPSC), definitive endoderm (DE), hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 4) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as from 3 PHH donors.

  Dataset EGAD00001005934

• Single cell transcriptomes of in vitro differentiated hepatocyte-like cells in comparison to primary human hepatocytes

  Fastq files of deeply sequenced single cell RNA-seq data (Smartseq2, approx. 2 million reads / sample) of hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 3) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as PHH from 3 donors. Each replicate comprises 96 single cells.

  Dataset EGAD00001005946

• Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient

  Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008012

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models enables specific monitoring of tumour-derived extracellular RNA

  Total RNA sequencing (SMARTer Stranded Total RNA-Seq Kit v2) data of extracellular RNA (exRNA) from liquid biopsies of a BRC0004PR PDX and SK-N-BE(2C) CDX mouse model, and total RNA sequencing profiles of the matching PDX tumors.

  Dataset EGAD00001008318

• Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010316

• Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010317

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  Whole genome sequencing data of 57 single (PTA), clonally expanded and bulk human cells. Cells were obtained from bone marrow samples of patients with Fanconi Anemia (PMCFANCNN) or pediatric AML (PBNNNNN), from a clonal intestinal organoid line (STE0072/D-ORGWTNISL), from human cord blood (PMCCB15) and from a human lymphoblastoid cell line (PMCAHH1). WGS libraries were sequenced to ~15-30x genomic coverage (paired-end) on an Illumina Novaseq.

  Dataset EGAD00001011126

• Targeted sequencing of vascular malformations tissues and paired blood samples

  In recent years, it has been clarified that various vascular malformations are caused by gene mutations. However, there remain vascular malformations of unknown etiology. In the present study, we investigated somatic mutations of three types of vascular malformations to identify novel gene mutations involved in their pathogenesis.

  Study JGAS000325

• Single-nucleus RNA sequencing (snRNA-seq) of seven human diffuse midline glioma (DMG) patient tumour samples.

  This dataset comprises 7 paired (14 total) FASTQ files of single-nucleus RNA sequencing (snRNA-seq) data generated from seven human diffuse midline glioma (DMG) patient tumour samples. snRNA-seq libraries were generated using the 10X Chromium Controller and Chromium Next GEM Single Cell 3’ kit version 3.1 in line with the manufacturer’s instructions. Generated libraries were sequenced on an Illumina NextSeq 2000 (P3 XLEAP-SBS chemistry) at targeted 20,000 reads per nucleus.

  Dataset EGAD50000002514

• RNA sequencing of tumor samples from patients with BPLL

  RNA-Seq was performed on 12 samples of sorted CD19+ tumor cells. RNA-Seq libraries were prepared using the SureSelect Automated Strand Specific RNA Library Preparation Kit as per manufacturer’s instructions (Agilent technologies) and subjected to paired-end (2 x 100 bp) sequencing on HiSeq2000 (Illumina). The files are in FASTQ format.

  Dataset EGAD00001004412

• Molecular profiling of DLBCL patients treated in the PETAL trial

  Shallow whole genome sequencing and targeted sequencing of DLBCL patients treated in the PETAL trial

  Dataset EGAD00001008386

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Comprehensive investigation of genome architecture of papillary thyroid cancer with whole-exon sequencing in the Chinese population.

  In this study, we performed whole-exon sequencing (WES) of 50 paired PTC tumors and adjacent normal tissues to identify novel potential biomarkers. We extracted mutational signatures which induce somatic mutations. Moreover, we observed copy number changes frequently occurring in some cancer related genes. Our study covers a comprehensive genetic framework that can be used in clinical trials and treatment modalities in PTC.

  Study EGAS00001002402

• DIS3 licenses B cells for physiological plasma cell differentiation in humans

  DIS3 licenses B cells for physiological plasma cell differentiation in humans

  Study EGAS50000000853

• RNAseq metadata

  Meta-data/patient information for the bulk RNAseq data

  Dataset EGAD00001008815

• WTCCC case-control study for Breast cancer - Combined Controls

  WTCCC genome-wide case-control association study for Breast cancer (BC) - Combined Controls.

  Study EGAS00000000025

• cfDNA dataset with expanded panel for cfDNA cohort

  Cell free DNA sequencing data for 9 samples with expanded panel across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000667

• PPGL RNA-Seq dataset 2

  Dataset includes fastq files for RNA-Seq experiments for tumor samples of PPGL patients. Single end reads fastq files are available for 81 different samples

  Dataset EGAD50000000019

• raw RNA-seq data from patients infected with COVID-19 or influenza

  Dataset consists of fastq files from bulk RNA-seq done on peripheral blood acquired from two well characterised hospitalised cohorts, a cohort of patients infected with influenza and a cohort of patients infected with SARS-CoV-2 during the first wave of the pandemic and prior to availability of COVID-19 treatments and vaccines.

  Dataset EGAD00001008505

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - DNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009812

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• cfDNA dataset with whole genome sequencing for cfDNA cohort

  Cell free DNA sequencing data for 13samples with whole genome sequencing across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000666

• RNASeq files for Klco PanAML data

  RNASeq files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011294

• WGS files for Klco PanAML data

  WGS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011295

• WXS files for Klco PanAML data

  WXS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011296

• Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Dataset EGAD00001012638

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• WTCCC case-control study for Ankylosing Spondylitis - Combined Controls

  WTCCC genome-wide case-control association study for Ankylosing Spondylitis (AS) - Combined Controls.

  Study EGAS00000000019

• WTCCC case-control study for Autoimmune Thyroid Disease - Combined Controls

  WTCCC genome-wide case-control association study for Autoimmune Thyroid Disease (ATD) - Combined Controls.

  Study EGAS00000000021

• Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Study EGAS00001003876

• RNASeq files for Stewart-MATCH

  RNASeq files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015475

• WXS files for MATCH paper

  WXS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015484

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975