17418 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 30.67 milliseconds.

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• ProstOmics - Bulk Transcriptomics

  Bulk transcriptomics data from 176 prostate tissue samples (37 patients, 27 with post-surgery relapse) that were acquired using the SENSE mRNA-Seq Library Prep Kit V2 and Illumina NextSeq 500 instrument. The raw transcriptomics data is single-read RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Patient metadata include information of age at surgery, time (months) until reported relapse, pre-surgery PSA and post-surgery T-stage.

  Dataset EGAD50000000604

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• 160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  Study EGAS00001002331

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  Dataset EGAD00001000760

• BipEx_Timpson_Bristol

  "BipEx_EGAS00001006274_Timpson_Bristol Controls Exomes. This research project was a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,981 Control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000144

• Massively Multiplex Single-Cell Hi-C of HeLa Cells

  In this study, we developed a massively multiplexed, single-cell Hi-C protocol to study the chromosomal architecture of single HeLa cells.

  Study phs001269

• Fungal infection in neural tissue from Amyotrophic Lateral Sclerosis

  The study shows that fungus infection, isolated from neural tissue, can be a risk factor to develop Amyothophic lateral sclerosis (ALS).

  Study EGAS00001002473

• Whole-exome sequencing of Fanconi anemia

  We performed whole-exome sequencing of two Fanconi anemia patients without mutation of known FA genes, and identified a novel FA gene FANCT.

  Study EGAS00001001103

• Benchmarking DIA-type Proteomics Using Large-Scale Inter-Patient Heterogeneity Dataset

  Benchmarking Proteomics Quantitation in DIA-type data using real patient material to create a benchmark dataset comprising inter-patient heterogeneity

  Study EGAS00001005589

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of γδ T cells FACS sorted from peripheral blood of two Merkel cell carcinoma patients

  Dataset EGAD50000000137

• Single Cell Sperm from fathers of Autistic Children

  Single cell sequencing of fathers who have had children with autism and fathers who have had multiple children, but no children with autism. The data was process on a 10X Chromium and sequenced on a NextSeq

  Dataset EGAD00001006292

• RNA-seq data from the tumor samples of a head and neck cancer patient

  This dataset contains paired-end RNA sequencing data (2x50 bp) from the three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006654

• Clinical cancer panel sequencing (UCSF500) analysis of TERT promoter duplication in GBM.

  Dataset contains paired-end clinical cancer panel sequencing (UCSF500) data from 2 samples of an initial tumor and one sample of a recurrence from one GBM patient and one sample from a second GBM patient.

  Dataset EGAD00001009286

• Single-cell mRNA-sequencing to generate a transcriptomic atlas of RMS

  Single-cell mRNA-sequencing to generate a transcriptomic atlas of soft tissue sarcoma tumors

  Dataset EGAD00001009385

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• Bolleboom-Gao peri-tumoral snRNA-seq glioblastoma dataset 2022/A

  Bolleboom-Gao peri-tumoral snRNA-seq glioblastoma dataset 2022/A

  Dataset EGAD00001009964

• Whole genome sequencing

  This dataset contains whole genome sequencing data from 22 samples of FACS-purified bone marrow CD34+ haematopoietic stem and progenitor cells and matched hair follicle controls collected from individuals undergoing hip replacement surgery. Additionally, it contains whole genome sequencing data from unseparated bone marrow mononuclear cells, CD3-CD34- bone marrow mononuclear cells, and peripheral blood granulocytes of the same 14 samples. Haematopoietic samples were sequenced to a target coverage of 90-120x; 19 of them were re-sequenced to a total target coverage of 270x. Hair follicle controls were sequenced to a target coverage of 30x.

  Dataset EGAD00001015178

• The Mexican-American Coronary Artery Disease Study (MACAD)

  The MACAD Study, funded by NHLBI, was designed to explore genetic contributions to coronary artery disease and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001397

• NCI Laboratory of Translational Genomics (LTG) Human Pancreas QTL study

  We created a human histologically normal pancreas eQTL resource using 91 fresh frozen tissue samples from patients diagnosed with pancreatic cancer (Mayo Clinic and Memorial Sloan Kettering Cancer Center) or from organ donors without a history of pancreatic cancer (Penn State University) by RNA-Sequencing. Genome wide genotyping was done using blood derived DNA samples or normal derived tissue samples. An average of ~369,4 million reads (paired end, stranded, 101 bp) and 724981 genotypes (per sample) were generated.

  Study phs001776

• The Hypertension-Insulin Resistance Family Study (HTN-IR)

  The HTN-IR Study, funded by NHLBI, was designed to explore genetic contributions to hypertension and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001394

• The Genetics of Lung Cancer Susceptibility in Smokers

  Over 85% of all patients diagnosed with lung cancer report a history of tobacco use, though only 10% of tobacco smokers eventually develop lung cancer. Epidemiologic studies have shown that family members of patients with lung cancer have a higher risk of developing lung cancer than controls. In an effort to identify variants associated with tobacco induced lung cancer, we have sequenced germline DNA from affected and unaffected members of families with strong histories of tobacco related lung cancer.

  Study phs000728

• Transcriptome sequencing of fibroblast-dependent alveolar organoids derived from patient-specific iPS cells with SFTPC^Y104H variant and their gene-corrected (monoallelic wild type SFTPC) ones.

  A disease-specific iPS cell line derived from a pulmonary fibrosis patient with SFTPC^Y104H and its gene-corrected (monoallelic wild type SFTPC) one were established. Then lung progenitor cells were differentiated from each cell line and co-cultured with human fetal lung fibroblasts to generate alveolar organoids, respectively. Alveolar epithelial cells and fibroblasts were isolated by fluorescence-activated cell sorting and each RNA was extracted. We performed transcriptome analysis of those samples by RNA-sequencing.

  Study JGAS000617

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  We developed a comprehensive bioinformatic workflow, called the PTA Analysis Toolbox (PTATO), to accurately detect single base substitutions, insertions-deletions (indels) and structural variants in PTA-based WGS data. PTATO includes a machine learning approach and filtering based on recurrency to distinguish PTA-artefacts from true mutations with high sensitivity (up to 90%), outperforming existing bioinformatic approaches. Our results show that PTATO enables studying somatic mutagenesis in the genomes of single cells with unprecedented sensitivity and accuracy.

  Study EGAS00001007288

• PRADO trial - Personalized response-directed surgery and adjuvant therapy after neoadjuvant ipilimumab plus nivolumab in stage III melanoma

  The PRADO trial tested a personalized response-directed treatment approach based on the pathologic response after neoadjuvant ipilimumab plus nivolumab in stage III melanoma patients. In patients achieving a major pathologic response, in their index lymph node (the largest lymph node metastasis at baseline), therapeutic lymph node dissection (TLND) and adjuvant therapy were omitted. Patients with partial response underwent TLND only, whereas patients with pathologic non-response underwent TLND and adjuvant systemic therapy ± synchronous radiotherapy.

  Study EGAS50000000268

• WES sequencing of malignant peripheral nerve sheath tumours

  Investigate the genomic landscape of MPNST tumours. Cases where a diagnosis of MPNST had been considered in the differential diagnosis with a variable degree of confidence was included. The diagnosis of MPNST was excluded in 12/51 (49 cases had WES data) of the sequenced tumours following review of the pathology, new IHC, molecular tests and clinical information. Article: Lyskjær et al, 2020, J Pathol, "H3K27me3 expression and methylation status in histological variants of malignant peripheral nerve sheath tumours".

  Study EGAS00001004527

• Mutational Landscape of Plasmablastic Lymphoma

  Plasmablastic lymphoma (PBL) represents a clinically heterogeneous subtype of aggressive B-cell non-Hodgkin lymphoma. Although targeted sequencing studies and a single center whole exome sequencing (WES) study in HIV+ patients recently revealed several genes, associated with PBL pathogenesis, the global mutational landscape and transcriptional profile of PBL remain elusive. To inform on disease-associated mutational drivers, mutational patterns and perturbed pathways in HIV+ and HIV- PBL we performed WES and RNA-sequencing (RNA-seq) of 34 PBL tumors.

  Study EGAS00001004906

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Gene expression profiles of matched primary and recurrent fresh frozen tumor tissues from 66 HGSOC patients were obtained by RNA sequencing. RNA libraries were created using the Illumina TruSeq RNA sample preparation kit V2 according to the manufacturer’s instructions and sequenced on a HiSeq2000 (Illumina, California, USA) using a V3 flowcell generating 1 x 50 bp reads. Raw sequencing reads were mapped to the transcriptome and the human reference genome (NCBI37/hg19) using TopHat 2.0 and Bowtie 2.0.

  Study EGAS00001002660

• Sequencing of an adolescent patient with germline RET mutant alveolar rhabdomyosarcoma

  An adolescent patient presented with an alveolar rhabdomyosarcoma made more unique by the presence of a germline RET mutation ordinarily associated with and a known driver of multiple endocrine neoplasia type 2A (MEN2A) cancer. To better understand the role of this germline RET mutation in the genetics and phenotypic response of this unique alveolar rhabdomyosarcoma, we performed DNA and RNA sequencing of the patients in addition to functional studies on patient-derived cultures and genetically similar similar cell models.

  Study EGAS00001004359