17536 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 28.13 milliseconds.

• Mutational Signatures of relapse in rectal cancer FFPE samples in the CR07 clinical trial

  The CRO7 clinical trial recruited patients with clinically operable rectal adenocarcinoma. Patients were randomized to either pre-operative short course surgery followed by chemo-radiotherapy only in those patients at high risk of local relapse. Patients in both arms the received standard %-FU based adjuvant chemotherapy as per local policy. We intend to use FFPE derived DNA from the primary tumours to identify patterns of mutations or copy number alterations that are predictive of local or distant relapse.

  Dataset EGAD00001000875

• McQuillin_Global_WES_Schizophrenia

  Whole Exome Sequencing of Schizophrenia cases and matched controls performed at the Broad Institute on a cohort from UCL, London, UK

  Study EGAS50000000901

• MBD4 targeted sequencing

  We sequenced a gene of interest, MBD4, in both germline (n=1099) and tumor (n=192) sample from Uveal Melanoma patients.

  Study EGAS00001005012

• Structural variants

  Structural variants assessed in 6 patient samples with varying phenotypes, through the use of sniffles2 with a support parameter of 1 and at a length of 30 bp

  Dataset EGAD50000000741

• KIT-dependent and -independent genomic heterogeneity of resistance in gastrointestinal stromal tumors - TORC1/2 inhibition as salvage strategy

  The mutational status of GIST analyzed with a broad sequencing approach (WES, RNAseq)

  Study EGAS00001003405

• ICGC Breast Cancer Project

  A comprehensive characterisation and analysis of human breast cancers through genome-wide approaches including genomics, transcriptomics and epigenomics.

  Study EGAS00001001195

• GermCellTumour

  DNA and RNA sequencing across a number of different germ cell tumours, included mixed components within the same tumour.

  Study EGAS00001003457

• checup

  Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial)

  Study EGAS00001007403

• Mosaic Colorectal Metastasis

  A comparison of the somatic variation present in a primary colorectal tumour and three different liver metastases from the same patient.

  Dataset EGAD00001000948

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• APCDR Uganda GWAS - High depth sequencing of a Baganda trio

  A family trio from Uganda (Baganda ethno-linguistic group) has been sequenced to high depth (ca. 30x) on the Illumina HiSeq 2500 platform.

  Dataset EGAD00001005346

• Targeted sequencing of HGS-EOC samples

  A 19-sample data set containing data from FFPE high grade serous ovarian cancer biopsies. The library was made with a custom hybridization kit (EZ-Cap, Roche) spanning 7 genes.

  Dataset EGAD00001006064

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  Dataset EGAD00001000149

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Whole-genome sequencing (WGS) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  We used WGS (Complete Genomics) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  Dataset EGAD00001003120

• Differentially methylated CpGs in response to growth hormone administration in children with idiopathic short stature

  Background: Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmaco-epigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS. Results: We measured DNA methylation profiles before and after GH treatment (with a duration of ~18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration, and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMC) that were enriched in promoter regions, CpG islands and blood cell-type specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development", "neuron differentiation" and "developmental growth", and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway. Conclusion: Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

  Study EGAS00001006115

• ProstOmics - Bulk Transcriptomics

  Bulk transcriptomics data from 176 prostate tissue samples (37 patients, 27 with post-surgery relapse) that were acquired using the SENSE mRNA-Seq Library Prep Kit V2 and Illumina NextSeq 500 instrument. The raw transcriptomics data is single-read RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Patient metadata include information of age at surgery, time (months) until reported relapse, pre-surgery PSA and post-surgery T-stage.

  Dataset EGAD50000000604

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• 160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  Study EGAS00001002331

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  Dataset EGAD00001000760

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978