17418 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 29.38 milliseconds.

• Study of Adaptation to Hypoxia in Ethiopian Highlanders via Whole Genome Sequencing

  Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome (either exons or a subset of SNPs) or a group of candidate genes, interpretation of the results was limited. We focused our study on Ethiopian highlander populations, which have been found to be well adapted to high altitudes (~3500m). We sequenced and analyze the genomes of 13 high altitude native Ethiopians: 6 individuals of Oromo heritage living on Bale Plateau (labeled "Oromos"), and 7 individuals residing on the Chennek field in the Simien Mountains (labeled "Amhara"). Our study revealed evolutionarily conserved genes that modulate hypoxia tolerance.

  Study phs000647

• PanProstate Cancer Group DK data

  THE PAN PROSTATE CANCER PROJECT: Many groups around the world have generated Whole Genome DNA Sequence (WGS) data from prostate cancer patients. The pan prostate group have gathered with the idea that the accumulated data, should be collected and compared in a common format including common storage, re-analysis through a single pipeline, and investigation to achieve a variety of scientific goals. The combined collection would include the following categories: (i) cancers from different ethnic groups: eg Caucasian, Asian, Black Caribbean; (ii) cancer from different stages of progression from normal, to organ-confined disease, to metastases; (iii) early-onset prostate cancer; (iv) prostate cancer from aggressive and indolent disease; and (v) prostate cancer patients managed by different treatments with information linked to long-term clinical follow up data in many cases.This study contains the samples from the Danish prostate group.

  Study EGAS50000001616

• Quantitative microbiome profiling disentangles inflammation- and bile duct obstruction-associated microbiota alterations across IBD/PSC diagnoses

  Disease-association microbiome dataset comprising 106 primary sclerosing cholangitis and/or inflammatory bowel disease (PSC/IBD) patients. Assessing quantitative taxon abundances, we study microbiome alterations beyond symptomatic stool moisture variation. We observe a high prevalence of a low cell count Bacteroides2 enterotype across patient groups when compared to healthy controls, with microbial loads correlating inversely with intestinal and systemic inflammation markers. Quantitative analyses allow us to differentiate between taxa associated to either intestinal inflammation severity (Fusobacterium) or cholangitis/biliary obstruction (Enterococcus) among previously suggested PSC marker genera. We identify and validate a near-exclusion pattern between the inflammation-associated Fusobacterium and Veillonella genera, with Fusobacterium detection being restricted to Crohn’s disease (CD) and PSC-CD patients. Overall, through absolute quantification and confounder control, we single out clear-cut microbiome markers associated to pathophysiological manifestations and disease diagnosis.

  Study EGAS00001003600

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• IYDP Indonesian Y chromosome Diversity Project

  Island Southeast Asia and Oceania host one of the world’s richest assemblages of human phenotypic, linguistic and cultural diversity. We compiled ~9.7 Mb of Y chromosome sequence from a diverse sample of over 380 men from this region, including 126 from Indonesian islands, first reported here. The granularity of this dataset allows us to fully resolve and date the regional Y chromosome phylogeny. This improved Y chromosome topology highlights localized events with important historical implications, including pre-Holocene contact between Mainland and Island Southeast Asia, ongoing interactions between Australia and the Papuan world, and a sustained period of diversification following the flooding of the ancient Sunda and Sahul continents as the insular landscape of today formed. The high-resolution phylogeny of the Y chromosome presented here thus enables a detailed exploration of past isolation, interaction and change in one of the world’s least understood regions.

  Study EGAS00001006028

• Application of high-throughput, high-depth, targeted single-nucleus DNA sequencing in pancreatic cancer

  Despite insights gained by bulk DNA sequencing of cancer it remains challenging to resolve the admixture of normal and tumor cells, and/or of distinct tumor subclones; high throughput single-cell DNA sequencing circumvents these and brings cancer genomic studies to higher resolution. However, its application has been limited to liquid tumors or a small batch of solid tumors, mainly because of the lack of a scalable workflow to process solid tumor samples. Here we optimized a highly automated nuclei extraction workflow that achieved fast and reliable targeted single-nucleus DNA library preparation of 38 samples from 16 pancreatic ductal adenocarcinoma (PDAC) patients, with an average library yield per sample of 2867 single nuclei. We demonstrate that this workflow not only performs well using low cellularity or low tumor purity samples but reveals novel genomic evolution patterns of PDAC as well.

  Study EGAS00001006024

• Single-cell RNA-seq of bronchoalveolar lavage (BAL) fluid in severe COVID-19 and SARS-CoV-2 stimulated classical blood monocytes

  We analyzed pulmonary monocyte and macrophage responses as well as and pulmonary pathology in two cohorts of patients with COVID-19 associated ARDS. Monocyte-derived macrophages accumulated in the lung during ARDS and acquired a profibrotic signature, characterized by high expression of known fibrogenic factors like TGFB1, SPP1 and LGMN. COVID-19 associated macrophages showed highly significant transcriptional similarity with profibrotic macrophage populations identified in idiopathic pulmonary fibrosis (IPF). Notably, overnight exposure to SARS-CoV-2, but not influenza A virus or viral RNA analogues, induced a similar phenotype in human monocytes from healthy volunteers in vitro. Patients with severe COVID-19 associated ARDS showed clear clinical, radiographic and histopathological features of scarring and fibrotic tissue remodeling. In conclusion, SARS-CoV-2 triggers profibrotic macrophage responses, fibroproliferative ARDS, and lung fibrosis

  Study EGAS00001004928

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• Neoantigen responses to Immunotherapy in Prostate Cancer

  To determine whether antigen-specific T cell responses can be elicited following treatment with ICT in cancers that have a low TMB, a clinical trial with ipilimumab (anti-CTLA-4) was conducted in 30 patients with metastatic castration-resistant prostate cancer (CRPC). We identified 2 distinct groups of patients divided by clinical outcomes, which consisted of a cohort with Favorable and Unfavorable outcomes. Compared to the Unfavorable cohort, the patients in the Favorable cohort were more likely to have higher intratumoral CD8 T cell density and/or IFN-γ response gene signature, including five patients who had antigen-specific T cell responses that were only detectable after ipilimumab therapy. Three patients had T cell responses against tumor-associated antigens (PSMA and PAP). Importantly, two patients with a relatively low TMB had T cell responses against unique neoantigens. Collectively, our data indicate that a subset of patients with metastatic prostate cancer benefit from ICTs, particularly those who have immunological biomarkers associated with effector T cell responses. Publication: Sumit K. Subudhi, Luis Vence, Hao Zhao, Jorge Blando, Shalini S. Yadav, Qing Xiong, Alexandre Reuben, Ana Aparicio, Paul G. Corn, Brian F. Chapin, Louis L. Pisters, Patricia Troncoso, Rebecca Slack Tidwell, Peter Thall, Chang-Jiun Wu, Jianhua Zhang, Christopher L. Logothetis, Andrew Futreal, James P. Allison and Padmanee Sharma, 2020, Neoantigen responses, immune correlates, and favorable outcomes after ipilimumab treatment of patients with prostate cancer. Science Translational Medicine, 01 Apr 2020:Vol. 12, Issue 537, eaaz3577DOI: 10.1126/scitranslmed.aaz3577. https://pubmed.ncbi.nlm.nih.gov/32238575/

  Study EGAS00001004050

• Clonal dynamics after allogeneic haematopoietic cell transplantation using genome-wide somatic mutations - WGS

  Allogeneic haematopoietic cell transplantation (HCT) replaces the stem cells responsible for blood production with those harvested from a donor, and is received by 40,000 patients worldwide each year. To quantify dynamics of long-term stem cell engraftment, we sequenced whole genomes of 2,824 single-cell-derived haematopoietic colonies from blood samples of 10 donor-recipient pairs taken 9-31 years after HLA-matched sibling HCT. With younger donors, 10,000-50,000 stem cells had engrafted and were still contributing to haematopoiesis at time of sampling, but estimates were 10-fold lower with older donors. Engrafted stem cells made multilineage contributions to myeloid, B-lymphoid and T-lymphoid populations, although individual clones often showed biases towards one or other mature cell type. Recipients had lower clonal diversity than matched donors, equivalent to ~10-15 years of additional ageing, arising from up to 25-fold greater expansion of stem cell clones. An HCT-related population bottleneck alone could not explain these differences: instead, phylogenetic trees evinced two distinct modes of HCT-specific selection. In 'pruning selection', cell divisions underpinning recipient-enriched clonal expansions had occurred in the donor, preceding transplant - their selective advantage derived from preferential mobilisation, harvest, survival ex vivo or initial homing. In 'growth selection', cell divisions underpinning clonal expansion occurred through proliferative advantage in the recipient's marrow after homing - clones with multiple driver mutations especially demonstrated this pattern. Uprooting stem cells from their native environment and transplanting them to foreign soil exaggerates selective pressures, distorting and accelerating the loss of clonal diversity compared to the unperturbed haematopoiesis of donors.

  Dataset EGAD00001010872

• A Phase II Study: CRS207/GVAX Plus Anti-PD1 and Anti-CTLA4 Recruits Mesothelin- and KRAS-Specific T cells into PDAC

  This study examined immunologic correlatives from a phase II study evaluating CRS207/GVAX vaccines in combination with anti-PD1 and anti-CTLA4 in metastatic pancreatic cancer (NCT03190265). Arm A received CRS207/GVAX with anti-PD1 and anti-CTLA4 therapy; Arm B received CRS207 with anti-PD1 and anti-CTLA4 therapy. Patients undergoing treatment in this trial had peripheral blood mononuclear cells (PBMCs) and tumor tissue biopsied serially at pre-treatment and on-treatment timepoints. Single-cell RNA/TCR sequencing was employed on PBMCs. Bulk RNA/TCR sequencing was employed on tumor tissues. We identified treatment-enriched inflammatory pathways as well as T cell repertoires.

  Study phs003798

• Proteomic Characterization of Intrahepatic Cholangiocarcinoma Identifies Risk-Stratifying Subgroups, Proteins Associated with Time-To-Recurrence, and mTOR Effector Molecule EIF4A1 as a Druggable Therapeutic Target

  Using mass spectrometry-based proteomics, we analyzed two independent cohorts comprising 80 and 62 treatment-naive ICC tumors, 67 adjacent non-malignant tissues, and 9 patient-derived xenografts (PDX). In the first cohort, we identifed two subclusters with distinct times-to-recurrence (TTR). A 4-protein classifier trained on our data cohort accurately stratifies these ICC clusters in the Dong et al. dataset (2022) and in our independent second cohort, revealing similar associations between proteomic motifs and clinical outcomes. The Translation regulator EIF4A1 emerges as a therapeutic target, as its inhibition with novel drug eFT226 significantly reduces tumor growth in an ICC PDX model.

  Study EGAS50000001343

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• EHMT2 alterations cause a Kleefstra-like syndrome

  We report clinical and molecular correlates associated with six de novo EHMT2 variants identified in patients presenting with a Kleefstra syndrome–like phenotype. Transcriptomic profiling of patient-derived fibroblasts and induced pluripotent stem cells (iPSCs) reveals shared gene expression signatures between EHMT2 variant carriers and Kleefstra syndrome, compared with cell lines derived from healthy donors.

  Study EGAS50000001637

• Three large nuclear families in which a single child per family was diagnosed with cancer

  We collected saliva samples from three nuclear families having 4, 5, and 7 children, respectively. One child in each nfamily had been diagnosed with a pediatric tumor, and neither parent had been diagnosed with cancer. Diagnoses included Wilms tumor, low-grade astrocytoma, and Burkitt’s lymphoma, respectively. We used whole-genome sequencing to profile normal cells from each family member and a linked-read technology.

  Dataset EGAD00001007709

• IMpower133 processed RNA-seq data for genes utilized for cluster assignments

  This dataset contains log2(TPM + 1) for 271 tumor samples profiled by RNA-seq for the subset of genes used for validation of the NMF cluster assignments.

  Dataset EGAD00001006928

• Comparison of sequencing assays for sensitive detection of circulating tumour DNA in stage IA-IV breast cancer

  This study compared different assays for the detection of circulating tumour DNA (ctDNA) in serial plasma from stage IA-IV breast cancer patients, targeting structural variants (SVs), single nucleotide variants (SNVs) and/or somatic copy-number aberrations (SCNAs). SV-multiplex PCR, SNV-/SV-hybrid capture, and different depths of whole-genome sequencing (WGS) were used to evaluate ctDNA levels, demonstrating concordant results. SNV-hybrid capture targeting 1,347-7,491 mutations was the most sensitive assay, detecting 67% (36/54) of samples down to an allele fraction (AF) of 0.00024%. SV-multiplex PCR, targeting 21-47 mutations, detected 63% (34/54) of samples down to 0.00047% AF and has potential as a clinical assay.

  Dataset EGAD00001008589

• The impact of BNT162b2 mRNA vaccine against SARS-CoV-2 on adaptive and innate immune responses

  The mRNA-based BNT162b2 protects against severe disease and mortality caused by SARS-CoV-2 through induction of specific antibody and T-cell responses. Much less is known about its broad effects on immune responses against other pathogens. In the present study, we investigated the specific adaptive immune responses induced by BNT162b2 vaccination against various SARS-CoV-2 variants, as well as its effects on the responsiveness of human immune cells upon stimulation with heterologous viral, bacterial, and fungal pathogens. BNT162b2 vaccination induced effective humoral and cellular immunity against SARS-CoV-2 that started to wane after six months. We also observed long-term transcriptional changes in immune cells after vaccination, as assessed by RNA sequencing. Additionally, vaccination with BNT162b2 modulated innate immune responses as measured by the production of inflammatory cytokines when stimulated with various microbial stimuli other than SARS-CoV-2, including higher IL-1/IL-6 release and decreased production of IFN-α. Altogether, these data expand our knowledge regarding the overall immunological effects of this new class of vaccines and underline the need of additional studies to elucidate their effects on both innate and adaptive immune responses.

  Study EGAS00001006818