17308 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 39.17 milliseconds.

• WGS and RNA-Seq data from a GBM patient PT-JW6420

  WGS and RNA-Seq data from a GBM patient PT-JW6420

  Dataset EGAD00001004248

• WGS and RNA-Seq data from a GBM patient PT-SK0976

  WGS and RNA-Seq data from a GBM patient PT-SK0976

  Dataset EGAD00001004260

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• WGS and RNA-Seq data from a GBM patient PT-LC6372

  WGS and RNA-Seq data from a GBM patient PT-LC6372

  Dataset EGAD00001008522

• Whole-genome sequencing (WGS) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  We used WGS (Complete Genomics) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  Dataset EGAD00001003120

• WGS and RNA-Seq data from a GBM patient PT-PD6881

  WGS and RNA-Seq data from a GBM patient PT-PD6881

  Dataset EGAD00001004255

• WGS and RNA-Seq data from a GBM patient PT-LC3356

  WGS and RNA-Seq data from a GBM patient PT-LC3356

  Dataset EGAD00001004250

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) tumor patient

  Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015320

• WGS and RNA-Seq data from a GBM patient PT-EV3071

  WGS and RNA-Seq data from a GBM patient PT-EV3071

  Dataset EGAD00001004234

• Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant tumor patient

  Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015326

• A Model of Human Asthma Exacerbation Identifies Mechanisms That Drive Allergic Asthma

  In this study, we will enroll allergic adults to undergo bronchoscopic segmental allergen challenge, in order to identify differences in the airway immune response to allergen in those with asthma compared to those without asthma. After a discussion about the study and potential risks, subjects giving written informed consent will undergo two bronchoscopies. During the first procedure, samples will be collected from the left lung and allergen will be administered to a small segment of the right lung. The second procedure will be performed 24 hours later, with collection of samples from the allergen-challenged lung segment.

  Study phs003101

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Targeted sequencing of diffuse large B-cell lymphoma tumour samples from the UK's Haematological Malignancy Research Network

  Targeted sequencing was applied to an unselected population-based diffuse large B-cell lymphoma cohort (n=928) diagnosed in the UK's Haematological Malignancy Research Network catchment population of ~4 million (14 centres). DNA extracted from tumour samples was sequenced with a 293-gene panel using the Illumina HiSeq 2500. All data are provided in the CRAM format.

  Dataset EGAD00001008616

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723