17536 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 28.41 milliseconds.

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• The impact of BNT162b2 mRNA vaccine against SARS-CoV-2 on adaptive and innate immune responses

  The mRNA-based BNT162b2 protects against severe disease and mortality caused by SARS-CoV-2 through induction of specific antibody and T-cell responses. Much less is known about its broad effects on immune responses against other pathogens. In the present study, we investigated the specific adaptive immune responses induced by BNT162b2 vaccination against various SARS-CoV-2 variants, as well as its effects on the responsiveness of human immune cells upon stimulation with heterologous viral, bacterial, and fungal pathogens. BNT162b2 vaccination induced effective humoral and cellular immunity against SARS-CoV-2 that started to wane after six months. We also observed long-term transcriptional changes in immune cells after vaccination, as assessed by RNA sequencing. Additionally, vaccination with BNT162b2 modulated innate immune responses as measured by the production of inflammatory cytokines when stimulated with various microbial stimuli other than SARS-CoV-2, including higher IL-1/IL-6 release and decreased production of IFN-α. Altogether, these data expand our knowledge regarding the overall immunological effects of this new class of vaccines and underline the need of additional studies to elucidate their effects on both innate and adaptive immune responses.

  Study EGAS00001006818

• WGS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  WGS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015697

• EHMT2 alterations cause a Kleefstra-like syndrome

  We report clinical and molecular correlates associated with six de novo EHMT2 variants identified in patients presenting with a Kleefstra syndrome–like phenotype. Transcriptomic profiling of patient-derived fibroblasts and induced pluripotent stem cells (iPSCs) reveals shared gene expression signatures between EHMT2 variant carriers and Kleefstra syndrome, compared with cell lines derived from healthy donors.

  Study EGAS50000001637

• Three large nuclear families in which a single child per family was diagnosed with cancer

  We collected saliva samples from three nuclear families having 4, 5, and 7 children, respectively. One child in each nfamily had been diagnosed with a pediatric tumor, and neither parent had been diagnosed with cancer. Diagnoses included Wilms tumor, low-grade astrocytoma, and Burkitt’s lymphoma, respectively. We used whole-genome sequencing to profile normal cells from each family member and a linked-read technology.

  Dataset EGAD00001007709

• Collaborative Cohort of Cohorts for COVID-19 Research (C4R): Atherosclerosis Risk in Communities Study (ARIC)

  Cohort Description The Atherosclerosis Risk in Communities (ARIC) study began in the mid-1980s with the initial aims being to describe the presence of subclinical atherosclerosis, the progression of atherosclerosis to clinical cardiovascular disease (CVD), and the association of novel risk factors with CVD. ARIC recruited its cohort of men and women aged 45-64 in 1987-89 from four communities (Forsyth County, NC; Jackson, MS; suburban Minneapolis, MN; and Washington County, MD). As of 2025, ARIC counts over 4,000 participants.Data Submitted Wave 1 questionnaire data includes 356 variables for up to 5763 ARIC participants in C4R. Wave 2 questionnaire data includes 367 variables for up to 5000 ARIC participants in C4R. Wave 3 questionnaire data includes 81 variables for up to 3450 participants in C4R.Dried Blood Spot/Serosurvey data includes 8 variables for up to 2437 ARIC participants in C4R. Derived data includes 62 variables for up to 18765 observations. Phenotype data includes 163 variables for up to 5937 ARIC participants in C4R. Brain MRI data includes 13 variables for up to 2550 participants in C4R.HCU data includes 21 variable for up to 631 ARIC participants in C4R.Lung CT data includes 15 variables for 1329 ARIC participants in C4R.Neurocognitive data includes 16 variables and 49826 observations.Serosurvey data includes 20 variables for 1707 ARIC participants in C4R.

  Study phs002988

• Single cell and plasma RNA sequencing

  Single cell and plasma RNA sequencing for RNA liquid biopsy for hepatocellular carcinoma

  Study EGAS00001005194

• Dataset for Manuscript: Cancer genome standards for long-read sequencing using cancer cell line mixtures

  Dataset for Manuscript: Cancer genome standards for long-read sequencing using cancer cell line mixtures

  Dataset EGAD00001015628

• FFPE WGS for optimizing mutation signature extraction from archival HGSC samples

  HGSC cases were selected for which matched fresh frozen and FFPE samples were available from the same tissue specimens. Fresh frozen, FFPE and normal blood were subject to WGS for the purpose of assessing the possibility of using FFPE WGS in place of fresh frozen for somatic mutation calling

  Study EGAS00001007521

• HGSC lines: ATACseq and RNAseq, pre- vs post-treatment with HKMTi-1-005

  Formation of a DAC to support the deposition of RNAseq and ATACseq data, from pre- vs post-treatment high-grade serous ovarian carcinoma cell lines. The lines include PEO1, PEO4, PEA2, OVCAR5, OVCAR8, and the treatment includes use of a novel epigenetic drug called HKMTi-1-005.

  Dac EGAC50000000034

• NINDS Inherited Forms of Motor Neuron Disease Study

  Sequencing data from primary fibroblasts were obtained from individuals with a family history of an inherited form of motor neuron disease (juvenile amyotrophic lateral sclerosis- ALS4).

  Study phs001322

• Human PI3Kγ Deficiency with Immunodeficiency and Tissue Immunopathology

  Whole exome sequencing of a trio (parents and offspring) reveals PIK3CG mutations that result in loss of protein in the child with immunodeficiency and immunopathology.

  Study phs001848

• BipEx_Landen_SWEBIC

  BipEx: Bipolar Exome Sequencing Broad & Karolinska Institutet. EGAS00001005860. "This research project was a collaboration between the Karolinska Institute and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of X SWEBIC Bipolar case samples from collaborators in Sweden. Genomic DNA from each samples was sequenced to a mean depth of 20x"

  Dac EGAC50000000142

• BipEx_Pedersen_Karolinska

  "BipEx: Bipolar Exome Sequencing Broad & Karolinska Institutet. EGAS00001005856. ""This research project was a collaboration between the Karolinska Institute BioBank and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 4,765 control samples from collaborators in Sweden. Genomic DNA from each samples was sequenced to a mean depth of 20x."" "

  Dac EGAC50000000141

• Exploring Genomic Mutations in Gastric Cancer among Japanese Populations

  We conducted a comprehensive analysis of whole-genome and RNA sequences obtained from biopsy samples of 65 patients with advanced gastric cancer prior to chemotherapy treatment.

  Study JGAS000754

• Metabolome analysis of persons with type 2 diabetes with or without diabetic complications

  We profiled serum metabolites of persons with T2D with or without diabetic complications using a comprehensive non-targeted metabolomics approach with mass spectrometry.

  Study JGAS000572

• Transcriptional Reference Map of Human Natural Killler Cells

  Here we performed single-cell RNA sequencing of both bulk NK and sorted NK subsets to establish a transcriptional reference map of human natural killer cells.

  Study EGAS50000000014

• Single-cell transcriptomic data of 9 DHG-H3G34 patient tumors.

  We applied single-cell/single-nucleus RNA-sequencing to a patient cohort of 9 fresh and frozen untreated diffuse hemispheric gliomas, H3G34-mutant (DHG-H3G34).

  Study EGAS50000000534

• Clonal_analysis_Bcell_activation

  We developed a B cell stimulation protocol that allowed us to expand a smaller number of naive B cells in culture (2,000 B cells at day 0). On day 6, we performed single-cell RNA-and BCR-sequencing on the entire culture, preserving both clonal diversity and size.

  Dataset EGAD50000002114

• Whole Exome Sequencing of Bipolar cases and matched a cohort from Edinburgh, Scotland, UK

  Whole Exome Sequencing of 1260 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Edinburgh, Scotland, UK. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000623

• DELFI low-coverage WGS of plasma cfDNA

  The dataset "DELFI low-coverage WGS of plasma cfDNA" includes paired FASTQ files produced by WGS of 689 plasma cfDNA samples from 153 patients with colorectal cancer. WGS (100bp PE) was performed on a NovaSeq 6000 with a target depth of coverage of 8x.

  Dataset EGAD50000000630

• Clonally heritable gene expression imparts a layer of diversity within cell types

  Human datasets associated with paper 'Clonally heritable gene expression imparts a layer of diversity within cell types' published in Cell Systems

  Dataset EGAD50000000231

• Non-coding RNAs in breast cancer

  Using RNA CaptureSeq we annotated non-coding RNAs transcribed from genome intervals surrounding breast cancer risk signals in a range of mammary-derived tissue and cell lines.

  Study EGAS00001003353

• Angiosarcoma_follow_up_study

  A bespoke targeted pulldown experiment will be performed on patients with Angiosarcoma. the resulting products will be sequenced to determine the prevalence of previously found mutations in these patients.

  Study EGAS00001000405