10648 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 17.75 milliseconds.

• Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci

  Multiple regulatory elements distant to their targets on the linear genome can influence the expression of a single gene through chromatin looping. Chromosome conformation capture implemented in Hi-C allows for genome-wide agnostic characterization of chromatin contacts. However, detection of functional enhancer-promoter interactions is precluded by its effective resolution that is determined by both restriction fragmentation and sensitivity of the experiment. Here we have developed a capture Hi-C (cHi-C) approach to allow an agnostic characterisation of these physical interactions on a genome-wide scale. Single nucleotide polymorphisms associated with complex diseases often reside within regulatory elements and exert effects through long-range regulation of gene expression. Applying this cHi-C approach to 14 colorectal cancer risk loci has allowed us to identify key long-range chromatin interactions in cis and trans involving these loci.

  Study EGAS00001001085

• Integrative sequencing reveals alterations in untreated and castration resistant prostate cancer

  We report the integrative sequencing of genomic, transcriptomic and DNA methylation changes in 28 untreated (PC) and 13 castration resistant prostate cancers (CRPC). AR, TGF-β and WNT signaling pathways were altered in CRPCs. We identified two new fusion genes, TMPRSS2-SKIL and DOT1L-HES6. Fusion analysis in an independent cohort validated SKIL as a recurrent 3’ fusion partner and oncogene in prostate cancer. The HES6 fusion was found in an AR-negative CRPC, and HES6 overexpression in vitro led to androgen independent growth. A distinct DNA methylation signature was found for CRPC. Transcriptome assembly uncovered 128 previously unannotated prostate cancer associated transcripts, including the ERG regulated transcript TPCAT-10-36067 whose knockdown had a dramatic effect on the growth, invasiveness, and rate of apoptosis of prostate cancer cells.

  Study EGAS00001000526

• BLUEPRINT ChIP-seq of Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

  Monocyte differentiation into macrophages represents a cornerstone process for host defense. Concomitantly, immunological imprinting of either tolerance or trained immunity determines the functional fate of macrophages and susceptibility to secondary infections. Transcriptomes and epigenomes in four primary cell types: monocytes, in vitro differentiated naïve, tolerized and trained macrophages were characterized. Inflammatory and metabolic pathways were modulated in macrophages, including decreased inflammasome activation, and pathways functionally implicated in trained immunity were identified. Strikingly, β-glucan training elicits an exclusive epigenetic signature, revealing a complex network of enhancers and promoters. Analysis of transcription factor motifs in DNase I hypersensitive sites at cell-type specific epigenetic loci unveiled differentiation and treatment specific repertoires. Altogether, this study provides a resource to understand the epigenetic changes that underlie innate immunity in humans.

  Study EGAS00001000951

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• Molecular patterns of response and treatment failure after frontline venetoclax combinations in older patients with AML

  This study assessed molecular determinants of response in a cohort of patients with AML that were treated with venetoclax in combination with either DNA methyltransferase inhibitors or low dose cytarabine. RNA sequencing was performed on 31 patients from three different response classes [10 Group A - Durable remission (n=10), Group B - Relapsed (n=10) and Group C - Refractory (n=11)]. Library preparation and sequencing was performed at the Australian Genome Research Facility, using the Truseq Stranded mRNA library kit. Technical and batch replicate samples are included, and these replicates are designated in the sample name. Gene count data are provided with the original publication. The use of the sequencing data is subject to a data transfer agreement and is restricted to ethically approved research into blood cell malignancies and cannot be used to assess germline variants.

  Study EGAS00001003820

• Epigenetic profiling of colorectal cancer initiating cells (CC-ICs) to identify bivalently marked genes (H3K4me3 and H3K27me3 ChIP-seq), and investigation of changes in transcriptome following EZH2 inhibition using RNA-seq.

  Epigenetic regulation of transcription plays a crucial role in lineage commitment of embryonic stem cells. Promoters of key lineage-specific differentiation genes are found in a repressed bivalent state, having both activating H3K4me3 and repressive H3K27me3 histone marks, making them poised for transcription upon loss of H3K27me3 in response to environmental cues. Whether the tumour-initiating, self-renewing, cancer-initiating cells (C-ICs) have similar epigenetic regulatory mechanism that prevent lineage commitment is unknown. In order to investigate bivalently marked and repressed promoters, we used a patient-derived CC-IC enriched model to identify the changes in transcriptome following inhibition of EZH2, the H3K27 methyltransferase. We also performed ChIP-seq for H3K27me3 and H3K4me3 at baseline in order to identify repressed and bivalently marked promoters.

  Study EGAS00001003003

• IYDP Indonesian Y chromosome Diversity Project

  Island Southeast Asia and Oceania host one of the world’s richest assemblages of human phenotypic, linguistic and cultural diversity. We compiled ~9.7 Mb of Y chromosome sequence from a diverse sample of over 380 men from this region, including 126 from Indonesian islands, first reported here. The granularity of this dataset allows us to fully resolve and date the regional Y chromosome phylogeny. This improved Y chromosome topology highlights localized events with important historical implications, including pre-Holocene contact between Mainland and Island Southeast Asia, ongoing interactions between Australia and the Papuan world, and a sustained period of diversification following the flooding of the ancient Sunda and Sahul continents as the insular landscape of today formed. The high-resolution phylogeny of the Y chromosome presented here thus enables a detailed exploration of past isolation, interaction and change in one of the world’s least understood regions.

  Study EGAS00001006028

• Spatial atlas of clonal copy number alterations in co-existing benign and malignant tissue

  Defining the transition from benign to malignant tissue is fundamental to improve early diagnosis of cancer. Here, we use a systematic approach to study spatial genome integrity in situ and describe previously unidentified clonal relationships. We employed spatially resolved transcriptomics to infer spatial copy number variations in >120,000 regions across multiple organs, in benign and malignant tissues. We demonstrate that genome-wide copy number variation reveals distinct clonal patterns within tumours and in nearby benign tissue using an organ-wide approach focused on the prostate. Our results suggest a model for how genomic instability arises in histologically benign tissue that may represent early events in cancer evolution. We highlight the power of capturing the molecular and spatial continuums in a tissue context and challenge the rationale for treatment paradigms, including focal therapy.

  Study EGAS00001006124

• Targeting AXL Kinase Uniquely Sensitizes Therapy-Insensitive Leukemic Stem and Progenitor Cells to Venetoclax Treatment in Acute Myeloid Leukemia

  The abundance of genetic abnormalities and phenotypic heterogeneities in AML pose significant challenges to developing improved treatments. Here we demonstrated that a key GAS6/AXL axis is highly activated in AML patient cells, particularly in leukemic stem cells. We developed a potent, selective AXL inhibitor that has excellent pharmaceutical properties and efficacy against preclinical patient-derived xenotransplantation models of AML. Importantly, inhibition of AXL sensitized AML stem/progenitor cells to venetoclax treatment, with strong synergistic effects in vitro and in vivo. Mechanistically, single-cell RNA-sequencing and functional validation studies uncovered that AXL inhibition or in combination with venetoclax potentially targets intrinsic metabolic vulnerabilities of AML stem/progenitor cells, which shows a distinct transcriptomic profile and inhibits mitochondrial oxidative phosphorylation. These findings have direct translational impact on the treatment of AML and other cancers with high AXL activity.

  Study EGAS00001004663

• Genomic_profiling_of_B_other_Adult_ALL_RNA

  Adult ALL is an aggressive leukaemia, affecting adults of all ages. It is associated with a rapid onset and poor outcomes. Our understanding of adult ALL genome has been limited to molecular markers first described in paediatric ALL and validated in adult ALL and to date there have been no studies investigating the genomics of Adult ALL. We will perform whole genome sequencing on at least 100 Adult ALL cases. Priority will be given on ALL cases without a known primary lesion by cytogenetic analysis which are categorised as “B-other”. We will also sequence representative cases of each known subtype. This will deliver a comprehensive annotation of the genomic landscape of Adult ALL to include acquired somatic mutations (substitutions, indels, structural variants/fusion genes) and copy number profiles. The focus on B-other Adult ALL is likely to result in new and previously undescribed genomic lesions.

  Study EGAS00001003428

• Application of high-throughput, high-depth, targeted single-nucleus DNA sequencing in pancreatic cancer

  Despite insights gained by bulk DNA sequencing of cancer it remains challenging to resolve the admixture of normal and tumor cells, and/or of distinct tumor subclones; high throughput single-cell DNA sequencing circumvents these and brings cancer genomic studies to higher resolution. However, its application has been limited to liquid tumors or a small batch of solid tumors, mainly because of the lack of a scalable workflow to process solid tumor samples. Here we optimized a highly automated nuclei extraction workflow that achieved fast and reliable targeted single-nucleus DNA library preparation of 38 samples from 16 pancreatic ductal adenocarcinoma (PDAC) patients, with an average library yield per sample of 2867 single nuclei. We demonstrate that this workflow not only performs well using low cellularity or low tumor purity samples but reveals novel genomic evolution patterns of PDAC as well.

  Study EGAS00001006024

• Single-cell RNA-seq of bronchoalveolar lavage (BAL) fluid in severe COVID-19 and SARS-CoV-2 stimulated classical blood monocytes

  We analyzed pulmonary monocyte and macrophage responses as well as and pulmonary pathology in two cohorts of patients with COVID-19 associated ARDS. Monocyte-derived macrophages accumulated in the lung during ARDS and acquired a profibrotic signature, characterized by high expression of known fibrogenic factors like TGFB1, SPP1 and LGMN. COVID-19 associated macrophages showed highly significant transcriptional similarity with profibrotic macrophage populations identified in idiopathic pulmonary fibrosis (IPF). Notably, overnight exposure to SARS-CoV-2, but not influenza A virus or viral RNA analogues, induced a similar phenotype in human monocytes from healthy volunteers in vitro. Patients with severe COVID-19 associated ARDS showed clear clinical, radiographic and histopathological features of scarring and fibrotic tissue remodeling. In conclusion, SARS-CoV-2 triggers profibrotic macrophage responses, fibroproliferative ARDS, and lung fibrosis

  Study EGAS00001004928

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• Beacon v2 and Federated EGA, part of the GDI project Starter Kit to enable access to genomic and phenotypic data across borders

  The European Genomic Data Infrastructure project has released a ‘Starter Kit’ based on the rare disease and cancer proof-of-concepts from the Beyond 1 Million Genomes (B1MG) project. The Starter Kit, freely available to any interested parties, contains a set of software applications and components co-developed by the 20 GDI nodes and based on open community standards from the Global Alliance for Genomics and Health (GA4GH). Products in the Starter Kit give all countries the technical capability to access synthetic genomic and phenotypic data across borders. The image above shows the full workflow of the GDI Starter Kit user journey. The dotted circles are not included in the Starter Kit yet The EGA’s work is represented in the Starter Kit with Beacon v2 and Federated EGA among the software applications and components. About Beacon v2 Beacon is a protocol for data discovery. This API allows the search of genomic variants and associated information without breaching the datasets privacy. The European Genome-phenome Archive (EGA) is a key contributor to the Beacon v2 Protocol, the Beacon v2 Reference Implementation (B2RI) and the EGA Beacon(s). About Federated EGA The Federated EGA network offers a tool for data storage and sharing. Officially launched in 2022, this network of connected resources enables transnational discovery of and access to human omics data for research, while also respecting jurisdictional data protection regulations. The Federated EGA Onboarding Website contains all the information related to the establishment of a Federated Node.

  Blog beacon-v2-and-federated-ega-part-of-the-gdi-project-starter-kit

• Genome wide association study of Coeliac Disease

  We performed a second-generation genome-wide association study of 4,533 individuals with celiac disease (cases) and 10,750 control subjects. We genotyped 113 selected SNPs with P(GWAS) < 10(-4) and 18 SNPs from 14 known loci in a further 4,918 cases and 5,684 controls. Variants from 13 new regions reached genome-wide significance (P(combined) < 5 x 10(-8)); most contain genes with immune functions (BACH2, CCR4, CD80, CIITA-SOCS1-CLEC16A, ICOSLG and ZMIZ1), with ETS1, RUNX3, THEMIS and TNFRSF14 having key roles in thymic T-cell selection. There was evidence to suggest associations for a further 13 regions. In an expression quantitative trait meta-analysis of 1,469 whole blood samples, 20 of 38 (52.6%) tested loci had celiac risk variants correlated (P < 0.0028, FDR 5%) with cis gene expression

  Study EGAS00000000057

• Cooperative activity of BRAF F595L and mutant HRAS in histiocytic sarcoma provides new insights into oncogenic BRAF signaling

  Mutations that activate the RAF-MEK-ERK signaling pathway, in particular BRAFV600E, occur in many cancers, and mutant BRAF-selective inhibitors have clinical activity in these diseases. Activating BRAF alleles are usually considered to be mutually exclusive with mutant RAS, whereas inactivating mutations in the D594F595G596 motif of the BRAF activation segment can coexist with oncogenic RAS and cooperate via paradoxical MEK/ERK activation. We determined the functional consequences of a largely uncharacterized BRAF mutation, F595L, which was detected along with an HRASQ61R allele by clinical exome sequencing in a patient with histiocytic sarcoma and also occurs in epithelial cancers, melanoma, and neuroblastoma, and investigated its interaction with mutant RAS. We demonstrate that, unlike previously described DFG motif mutants, BRAFF595L is a gain-of-function variant with intermediate activity towards MEK that does not act paradoxically, but nevertheless cooperates with mutant RAS to promote oncogenic signaling. Of immediate clinical relevance, BRAFF595L shows divergent responses to different mutant BRAF-selective inhibitors, whereas signaling driven by BRAFF595L with and without mutant RAS is efficiently blocked by pan-RAF and MEK inhibitors. Mutation data from primary patient samples and cell lines show that BRAFF595L, as well as other BRAF mutations with intermediate activity, frequently coincide with mutant RAS in a broad spectrum of cancers. These data define a novel class of activating BRAF mutations that cooperate with oncogenic RAS in a non-paradoxical fashion to achieve an optimal level of MEK-ERK signaling, extend the spectrum of patients with systemic histiocytic disorders and other malignancies who are candidates for therapeutic blockade of the RAF-MEK-ERK pathway, and underscore the value of comprehensive genetic profiling for understanding the signaling requirements of individual cancers.

  Dataset EGAD00001001384

• Single Cell Analysis of Human Airways in Healthy and Asthma volunteers

  Bronchoscopies were collected from healthy and asthma volunteers. Cohort inclusion criteria for all subjects were: age between 40 – 65 years and history of smoking &lt; 10 pack years. For the asthmatics, inclusion criteria were: age of onset of asthmatic symptoms ≤12 years, documented history of asthma, use of inhaled corticosteroids with(out) β2-agonists due to respiratory symptoms and a positive provocation test (i.e. PC20 methacholine ≤8mg/ml with 2-minute protocol). For the non-asthmatic controls, the following criteria were essential for inclusion: absent history of asthma, no use of asthma-related medication, a negative provocation test (i.e. PC20 methacholine &gt;8 mg/ml and adenosine 5'-monophosphate &gt;320 mg/ml with 2-minute protocol), no pulmonary obstruction (i.e. FEV1/FVC ≥70%) and absence of lung function impairment (i.e. FEV1 ≥80% predicted). Asthmatics stopped inhaled corticosteroid use 6 weeks prior to all tests. All subjects were clinically characterised with pulmonary function and provocation tests, blood samples were drawn, and finally subjects underwent a bronchoscopy under sedation. If a subject developed upper respiratory symptoms, bronchoscopy was postponed for ≥6 weeks. Fibreoptic bronchoscopy was performed using a standardised protocol during conscious sedation. Six macroscopically adequate endobronchial biopsies were collected for this study, located between the 3rd and 6th generation of the right lower and middle lobe. Extracted biopsies were processed directly thereafter, with a maximum of one hour delay. The medical ethics committee of the Groningen University Medical Center Groningen approved the study, and all subjects gave their written informed consent.

  Dataset EGAD00001005064

• The impact of mutational clonality in predicting the response to anti-PD-L1/PD-L1 in advanced urothelial cancer

  The advent of immune checkpoint inhibitors (ICI) has radically changed the management and therapeutic treatment landscape for patients with cancer. It has been shown that the use of these inhibitors can result in long-term complete remissions even in cases with advanced stages of the disease. However, only a small fraction of patients respond to the treatment. A better understanding of which factors could drive this clinical benefit is fundamental to building more accurate predictive biomarkers and developing alternative therapeutic options for patients who are unlikely to benefit. In order to address this issue, we have generated and analyzed whole exome sequencing (WES) and RNA sequencing (RNASeq) data from a cohort of metastatic urothelial carcinoma patients (N = 27) treated with ICI such as anti-PD-(L)1 monoclonal antibodies.

  Study EGAS00001007086

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from &gt;10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• Cancer of Low survival and UnMet Need – Pathologist Initiated

  Despite significant advances in diagnostic cancer histopathology, a subset of tumors remain unable to be classified using WHO criteria. The resulting diagnostic uncertainty can result in inappropriate clinical management and negative patient outcomes. We investigated whether combining histopathology with whole genome and transcriptome sequencing (WGTS) could improve the classification of tumors that posed diagnostic dilemmas despite extensive histopathology and standard molecular work-up at a quaternary oncology center. We successfully sequenced 45 tumors from an initial set of 54 unclassified tumors (83% success rate). A confident diagnosis was made for 38/45 tumors (84%). Additionally, potential treatment targets were identified in 21/45 tumors (47%). Theoretical comparison with alternative assays demonstrated that WGTS was uniquely capable of detecting critical diagnostic findings in 15/38 tumors (39%). This work supports augmenting histopathology and standard molecular pathology with WGTS in the classification of difficult-to-diagnose tumors.

  Study EGAS00001008112

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423