10741 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 28.56 milliseconds.

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• HV31 - De novo assembly of eight immune system regions

  De novo assembly of eight immune system regions for individual HV31, generated using a multi-platform pipeline. A full description of the generation of these assemblies can be found at https://doi.org/10.1101/2021.02.03.429586.

  Dataset EGAD00001007050

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Characterization_of_individual_foci_of_multicentric_multifocal_breast_cancer_using_targeted_next_generation_sequencing

  Multifocality or multicentricity in breast cancer may be defined as the presence of two or more tumor foci within a single quadrant of the breast or within different quadrants of the same breast, respectively. This original classification of the breast cancer as multicentric or multifocal was based on the assumption that cancers arising in the same quadrant were more likely to arise from the same ductal structures than those occurring in separate areas of the breast. The problem with these definitions is that the “quadrants” of the breast are arbitrary external designations, as no internal boundaries do exist. This project will therefore focus both on synchronous multifocal and multicentric tumors. The incidence of multifocal and multicentric breast cancers was reported to be between 13 and 75% depending on the definition used, the extent of the pathologic sampling of the breast and whether in situ disease is considered evidence of multicentricity (1). Although this incidence is variable, those figures show that it is a frequent phenomenon. Multiple (multifocal/multicentric) breast carcinomas, especially when occurring in the same breast, represent a real challenge for both pathologists and clinicians in terms of identifying the cellular origin and the best therapeutic management of the cancer. Multifocality or multicentricity has been associated with a number of more aggressive features including an increased rate of regional lymph node metastases and adverse patient outcome when compared with unifocal tumors (2-3), and a possible increased risk of local recurrence following breast conserving surgery (4). For the moment, the literature is divided on whether there is a corresponding impact on survival outcomes. Today, the current convention to stage and to treat multifocal and multicentric tumors is the classical tumor-node-metastasis (TNM) staging guidelines with which tumor size is assessed by the largest tumor focus without taking other foci of disease into consideration. If some papers, as the recent one from Lynch and colleagues, support the current staging convention (3), others, however, as Boyages et al. suggested that aggregate size and not the size of the largest lesion should be considered in order to refine the prognostic assessment of those tumors (5). On the top of that, the question whether multifocal/multicentric carcinomas are due to the spread of a single carcinoma throughout the breast or is due to multiple carcinomas arising simultaneously has been a matter of debate. Some studies suggested that multifocal breast cancer may result from either intramammary spread from a single primary tumor or multiple synchronous primary tumors; whereas others suggest that multiple breast carcinomas always arise from the same clone (6-8). Recently, Pietri and colleagues analyzed the biological characterization of a series of 113 multifocal/multicentric breast cancers (8) which were diagnosed over a 5-year period. The expression of estrogen (ER) and progesterone (PgR) receptors, Ki-67 proliferative index, expression of HER2 and tumor grading were prospectively determined in each tumor focus, and mismatches among foci were recorded. Mismatches in ER status were present in 5 (4.4%) cases and PgR in 18 (15.9%) cases. Mismatches in tumor grading were present in 21 cases (18.6%), proliferative index (Ki-67) in 17 (15%) cases and HER2 status in 11 (9.7%) cases. Interestingly, this heterogeneity among foci has led to 14 (12.4%) patients receiving different adjuvant treatments compared with what would have been indicated if we had only taken into account the biologic status of the primary tumor. This study therefore showed that differences in biological characteristics of multifocal/multicentric lesions play a crucial role in the adjuvant treatment decision making process. In this study, we will concentrate on a larger series of patients with multifocal invasive ductal breast cancer lesions. We aim at: 1. Evaluating the incidence of multifocality according to the different breast cancer molecular subtypes (ER-/HER2-, HER2+, ER+/HER2-). 2. Evaluating the incidence of multifocality in patients with hereditary breast cancer disease (presence of germline BRCA1 or BRCA2 mutations). Moreover, we would like to investigate if multifocal lesions with BRCA1 or BRCA2 mutations exhibit a characteristic combination of substitution mutation signatures and a distinctive profile of deletions as demonstrated recently by Nik-Zainal and colleagues (9). 3. Correlating multifocality with clinical information in order to define its influence on patients’ survival (DFS and OS). 4. Carrying high coverage targeted gene sequencing of driver cancer genes and genes whose mutation is of therapeutic importance in order to compare clinically-relevant genetic differences between several multifocal breast cancer lesions. 5. Evaluating the impact of the distance between the different lesions on the clinical outcome but also on the genetic differences. 6. Comparing gene expression patterns between several multifocal breast cancer lesions and correlate them with the results of the targeted genes screen. 7. Characterizing the genomic and transcriptomic status of cancer related genes in metastatic lesions (local recurrence, positive lymph node or distant metastatic sites) from the same multifocal invasive ductal breast cancer patients in order to evaluate the consequence of genomic and transcriptomic heterogeneity of multifocal lesions on metastatic lesions. Multiple (multifocal/multicentric) breast carcinomas, especially when occurring in the same breast, represent a real challenge for both pathologists and clinicians in terms of identifying the cellular origin and the best therapeutic choice. This project has the potential to identify genetic/transcriptomic differences existing between several lesions constituting multifocal breast cancers, which in the routine clinical practice are usually considered to be homogeneous among them. We foresee validating significant results in a larger series of patients and this, in turn, could have a remarkable impact on the treatment and clinical management of multifocal breast cancers. Indeed, we hope to provide some evidence whether or not each focus matters in multifocal and multicentric breast cancer to define the adequate therapeutic approach, especially in the context of targeted therapies. The work to be done at Sanger will be target gene screen pooling of 1400 samples.

  Study EGAS00001000407

• NHLBI TOPMed: Defining the Time-Dependent Genetic and Transcriptomic Responses to Cardiac Injury Among Patients with Arrhythmias

  The UMMS miRhythm Study is an ongoing study of adult patients undergoing an elective electrophysiology study or arrhythmia ablation procedure for a supraventricular or ventricular arrhythmia, including atrial fibrillation (AF). Atrial fibrillation is a major clinical and public health problem that is related to atrial pathologic remodeling. Few tools are available to quantify the activity or extent of this remodeling, rendering it difficult to identify individuals at risk for AF. Previous studies have suggested an important role for miRNA in cardiovascular disease through gene expression regulation, making this a promising avenue for studying AF mechanisms. The aim of the study is to determine the time-dependent changes to key circulating miRNAs in a model of planned atrial injury and remodeling via ablation. Such knowledge might provide additional insight into the biology and activity of the acute atrial injury response, and furthermore, inform new targets for development of preventative interventions or allow for better AF risk stratification. To assess pathways regulating atrial pathological remodeling, patient blood samples are collected prior to their ablation procedures and also at a regularly scheduled 1-month follow-up appointment. Plasma expression of miRNA is measured using high-throughput quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), providing novel insights into the regulatory processes underlying AF, as well as acute atrial injury in vivo. Additionally, data collected from whole-genome sequencing (WGS) is used to supplement miRNA analyses and further explore new relations between genes and abnormal heart rhythm.

  Study phs001434

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Clonally selected lines after CRISPR/Cas editing are not isogenic

  The CRISPR-Cas9 system has enabled researchers to precisely modify/edit the sequence of a genome. A typical editing experiment consists of two steps: (i) editing cultured cells and (ii) selection of clones, which are presumed to be isogenic, with and without the intended edit. The application of the CRISPR-Cas9 system may result in off-target edits, while cloning would reveal culture-acquired mutations. We analyzed the extent of the former and of the latter by whole genome sequencing (WGS) involving separate genomic loci in three experiments conducted by three independent laboratories. In all experiments we hardly found any off-target edits, while we detected hundreds to thousands of single nucleotide mutations unique to each clone after relatively short culture of 10-20 passages. Notably, clones also differed in copy number alterations that were several kb to several mb in size, representing the largest source of genomic divergence among clones. This study in dbGaP includes data from experiments carried out by investigators at the Oklahoma Medical Research Foundation and Baylor College of Medicine (OMRF/BCM) involving an iPSC line derived from fibroblasts of a female patient (line c7) carrying a constitutional heterozygous variant (chr1:1,464,679 C>T; GRCh37) in exon 15 of the ATPase family, AAA domain containing 3A (ATAD3A) gene. The parental line was edited by introducing a double stranded break at the variant allele to correct the variant by homology directed repair. Two unedited control clones (clone7 and clone8) and one edited clone (SC20) were selected for WGS.

  Study phs003110

• eMERGE: Genetics of Complex Pediatric Disorders from the Center for Applied Genomics

  The Center for Applied Genomics (CAG) is a specialized Center of Emphasis at the Children's Hospital of Philadelphia (CHOP) with the primary goal of translating basic research findings to medical innovations. The mission of CAG is to develop new and better ways to diagnose and treat children affected by rare and complex medical disorders. We aim to discover genetic causes for the most prevalent diseases of childhood including asthma, autism, diabetes, epilepsy, obesity, schizophrenia, pediatric cancer, and a range of rare diseases. Ultimately, our objective is to generate new diagnostic tests and to guide physicians to the most appropriate therapies. The CAG is one of the world's largest genetics research programs in pediatrics, and the only center at a pediatric hospital to have established a large-scale biobank of genotyped samples. The electronic Medical Records and Genomics (eMERGE) Network is a consortium of 9 clinical sites with EMR linked DNA biobanks, including Northwestern University and its NUgene biobank, funded by the NHGRI (National Human Genome Research Institute) to investigate the use of electronic medical record systems for genomic research. The goal of eMERGE is to conduct genome-wide association studies in approximately 100,000 individuals using EMR-derived phenotypes and DNA from linked biorepositories. Using electronic phenotyping methods, the consortium has been and is using DNA samples from all participating sites to explore the genetic determinants of approximately 80 phenotypes, including both diseases and traits, for which the electronic phenotyping algorithms have or are being published on PheKB.org.

  Study phs001165

• The Neonatal Microbiome and Necrotizing Enterocolitis

  The Neonatal Microbiome and Necrotizing enterocolitis (NEC) study is a multi-centered case control study testing the hypothesis that NEC is a direct or indirect consequence of the enteric biomass, its products, or both. Very low birth weight infants (VLBW; birth weight ≤ 1500 grams) admitted to the neonatal intensive care unit are prospectively followed over the first 5 week or until they reach 36 weeks gestation, whichever occurs later. VLBW infants with a lethal clinical condition are excluded. Over the course of the study period, prospective samples are obtained on all infants, and include all stools, and weekly blood samples, palm and oral swabs. Clinical data is collected over the course of the entire hospitalization. Cases are identified based on Bell's staging for NEC, requiring Bell's stage II (abdominal clinical signs and radiographic evidence of pneumatosis, portal venous gas or pneumoperitoneum). Controls are identified from the pool of prospectively enrolled subjects, matching for gestational age, birth weight, post-natal age and birth date. The microbial components of stool and its products before and at the onset of NEC, are then compared between cases and controls. The Aims of this proposal are to (1) conduct a case cohort study in which we compare clinical data and biological specimens from cases and well-matched controls; (2) determine if the kind and density of intestinal biomass, its gene content, and transcriptional activity are associated with, and potential determinants of, NEC; and (3) determine if host risk alleles for intestinal inflammation play a role in the development of NEC.

  Study phs000247

• Early Methamphetamine Abstinence: fMRI and Brain Function

  This study included two groups of subjects, methamphetamine-dependent and healthy control participants, with the purpose of characterizing brain structure and cognition during the first month of abstinence from methamphetamine. Participants were able to participate in one or both phases of the study. Methamphetamine abusers were held as inpatients and abstained from methamphetamine use during the entirety of the study. Phase I covered the 1st week of abstinence and Phase II covered the next 3-4 weeks of abstinence. Control subjects participated as outpatients at timeframes which corresponded to the assessments taken of methamphetamine users. The following outlines the procedures in more detail. After initial telephone screening, in-person screening and recruitment procedures took place at the UCLA Neuropsychiatric Institute. Each methamphetamine abuser subject entered the study after completing an interview and questionnaires on drug use history, and providing a positive urine test for methamphetamine. The evaluation included a psychiatric diagnostic interview according to the Structured Clinical Inventory for DSM-IV (SCID-IV), a medical history and physical examination, blood tests [including a complete chemistry panel, hepatic panel, and tests for hepatitis-C and HIV]. Urine samples were also taken for drug screening of illicit drugs, and to test for pregnancy (female subjects). The methamphetamine abusers were then admitted to the General Clinical Research Center (CRC) and participated on a residential basis, where they were administered daily questionnaires about drug craving, withdrawal and mood. The current study makes available phenotype and genotype data, and interested investigators may contact the principal investigator regarding potential sharing of fMRI data.

  Study phs001198

• Rare Diseases Clinical Research Network (RDCRN) Vasculitis Clinical Research Consortium (VCRC) Longitudinal Protocol for Polyarteritis Nodosa

  The development and validation of accurate biological markers and predictors of disease activity and outcome in Polyarteritis Nodosa (PAN), a form a idiopathic vasculitis, would have a major positive impact on the clinical care of patients with this rare disease, be an important advance in the design of clinical trials and feasibility of new drug development, and provide important insight into the pathogenesis of this condition. Current measures of disease activity, including erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP), while helpful in selected settings, are mostly considered highly flawed and markers whose poor correlation with disease flares makes them inadequate to help guide therapy. Similarly, ESR and CRP are clearly unhelpful as diagnostic tests for vasculitis. The current state of clinical investigation for vasculitis relies heavily upon determination of disease status solely by clinical presentation and investigator opinion. Thus, discovery and validation of more precise markers that quantifiably measure activity, predict disease course, and correlate with an important biological process, would be of great importance. Knowledge to be gained from this study could potentially be highly important. Discovery of effective biomarkers of vasculitis and assessment of long term disease course and complications by the collection of clinical and diagnostic imaging studies proposed could lead to better care and less toxic treatment regimens. Furthermore, insight into the pathophysiology of vasculitis could be gained and this might lead to better treatments and improved outcomes in terms of reduction of vascular and treatment related complications. Ideally, excellent biomarkers reflect a sophisticated understanding of the pathophysiology of a disease.

  Study phs000590

• Genetics of Mood Disorders: Aging and Emotion Regulation Brain Circuitry in Bipolar

  This single-site study is designed to investigate age-related changes in structure and function of a ventral prefrontal cortex (VPFC) neural system, that subserves emotion processing and regulation, during mid to later adulthood in individuals with bipolar disorder (BD), compared to healthy controls (HC). It is a 5-year study of age-related changes in mood, emotion regulation and related symptoms and behaviors using multimodality imaging measures [structural magnetic resonance imaging (MRI) of gray matter, diffusion tensor imaging (DTI) of white matter, and functional MRI measures of functional connectivity and of brain responses during implicit and explicit emotion regulation] comparing BD and HC groups ages 40-79 years, 50% female; a subgroup will be reassessed and rescanned after 2 years to study brain and associated behavioral changes over time. We will explore relationships between brain aging with risk factors implicated in progression. This will include genes, as well as adverse outcomes of progression such as suicide ideation and behavior. As there has been little study of effects of aging of the VPFC emotional circuitry in healthy individuals, findings could provide new insights into brain circuitry and emotional regulation in older adults. In addition to the importance of contributing to understanding BD, as BD is unique in having both elevated and depressive episodes, its study can provide a model for understanding progressive emotion dysregulation to both intervention and prevention that can be better targeted specifically for older individuals with BD. A de-identified blood sample will be sent to the Repository and Genomics Resource.

  Study phs001631

• Non-Coding Autoimmune Risk Variant Defines Role for ICOS in T Peripheral Helper Cell Development

  Our fine-mapping of 76 non-MHC loci associated with risk for rheumatoid arthritis (RA, 11,475 cases, 15,870 controls) has recently identified rs117701653, a non-coding single nucleotide polymorphism (SNP) in the CTLA4/CD28/ICOS locus, as the variant most likely to modulate RA risk within this region, with the minor allele C showing disease protection compared to the major allele A. We found that this SNP exhibits allele-specific protein binding and transcriptional modulation, further supporting its regulatory nature. Here, we aimed to determine whether the functional non-coding variant rs117701653 modulates the expression of genes within the CD28/CTLA4/ICOS locus. To address this question, we employed low-input RNA sequencing using the Illumina SmartSeq2 platform on resting total CD4+ T cells from the blood of 24 healthy subjects (8 AA, 8 AC, 8 CC) recruited based on genotype from the Mass General Brigham biobank. We performed a targeted cis-eQTL mapping analysis for protein coding genes with transcription start sites (TSS) within a 1MB window of SNP rs117701653. These genes included WDR12, NBEAL1, CYP20A1, ABI2, RAPH1, CD28, CTLA4, ICOS, and PARD3B. Surprisingly, allelic variation at rs117701653 correlated strongly with expression of ICOS. This suggests that individuals carrying the protective allele C at rs117701653 express lower levels of ICOS, implicating ICOS as a plausible target gene influenced by this protective allele. The raw sequence data from the 24 healthy individuals are available through dbGAP. Gene expression matrices have been deposited to GEO accession GSE235868.

  Study phs003448

• NCI Cancer Model Development for the Human Cancer Model Initiative (HCMI)

  The Cancer Model Development Center (CMDC) project is part of the Human Cancer Model Initiative (HCMI) and is managed by the Office of Cancer Genomics within the Center for Cancer Genomics at the National Cancer Institute (NCI). The goal of the HCMI is to generate approximately 1000 novel human "next generation" tumor-derived models as a community resource. The models aim to faithfully recapitulate the cellular complexity and heterogeneity of human tumors. The CMDCs are tasked by the NCI with producing a proportion of the cancer models. Wellcome Sanger Institute (WSI) is a contributing member of the HCMI. Models developed by HCMI are being derived from a number of tumor types and subtypes (see below), including rare adult, pediatric and understudied cancers. The number of models and the clinical sites from which patient samples are acquired is increasing. Normal tissue, originating tumor, and tumor-derived models are sequenced. The next generation cancer models are associated with rich clinical and genomic data through the NCI Genomic Data Commons for all researchers to advance cancer research. The CMDC and HCMI models will serve as excellent tools in research to provide insight into the pathways that influence tumor growth and progression, how tumors respond to therapy, etc. Ultimately, the data generated using these models will support the development of personalized oncology. There is a delay between registered IDs and model availability. The current model count is found in The HCMI Searchable Catalog which is updated when new models are available for distribution to the research community.

  Study phs001486

• PCPT and SELECT Cohorts: Core Infrastructure Support for Cancer Research

  SELECT study: SELECT was a phase III, double-blind, placebo-controlled 4-arm study of selenium, vitamin E, selenium and vitamin E together, and placebo designed to assess the effect of these supplements on the incidence of prostate cancer. Funded by the National Cancer Institute and conducted by SWOG, the study opened in August 2001 and quickly exceeded its accrual goal of 35,533 men.In the fall of 2008, the trial's Data Safety and Monitoring Committee recommended that participants discontinue taking study supplements due to convincing evidence (planned interim futility analysis) that neither vitamin E nor selenium supplements were associated with the prevention of prostate cancer. A subsequent analysis in 2011 showed a significant 17% increase in prostate cancer incidence in participants who were on the vitamin E only arm. Approximately 17,000 participants from the original trial recently completed an additional four years of centralized follow-up. This follow-up ended on May 31, 2014 and SELECT is now closed. PCPT study: The Prostate Cancer Prevention Trial (PCPT) was a SWOG Cancer Research Network-coordinated study designed to test whether the drug finasteride (Proscar®) would prevent prostate cancer in men ages 55 and older. This study was closed on June 24, 2003 because the study objective had been reached. The results of the study, which did find a preventive benefit for the drug, were published as "The Influence of Finasteride on the Development of Prostate Cancer," in the New England Journal of Medicine on July 17, 2003.

  Study phs003382

• Nanopore sequencing of blood, saliva, buccal mucosa samples of patients with inherited retinal disorders

  X-linked genetic disorders typically affect females less severely than males due to the presence of a second X chromosome not carrying the deleterious variant. However, the phenotypic expression in females is highly variable, which may be explained by an allelic skew in X chromosome inactivation. Accurate measurement of X inactivation skew is crucial to understand and predict disease phenotype in carrier females, with prediction especially relevant for degenerative conditions. We propose a novel approach using nanopore sequencing to quantify skewed X inactivation accurately. By phasing sequence variants and methylation patterns, this single assay reveals the disease variant, X inactivation skew, its directionality, and is applicable to all patients and X-linked variants. Enrichment of X-chromosome reads through adaptive sampling enhances cost-efficiency. Our study includes a cohort of 16 X-linked variant carrier females affected by two X-linked inherited retinal diseases: choroideremia and RPGR-associated retinitis pigmentosa. As retinal DNA cannot be readily obtained, we instead determine the skew from peripheral samples (blood, saliva and buccal mucosa), and correlate it to phenotypic outcomes. This revealed a strong correlation between X inactivation skew and disease presentation, confirming the value in performing this assay and its potential as a way to prioritise patients for early intervention, such as gene therapy currently in clinical trials for these conditions. Our method of assessing skewed X inactivation is applicable to all long-read genomic datasets, providing insights into disease risk and severity and aiding in the development of individualised strategies for X-linked variant carrier females.

  Study EGAS50000000440

• Study on the Genetics of Alcoholism (COGA): Smoke Screen and Exome Sequencing

  This is a family study of alcoholism, in which the subjects have been drawn from the Collaborative Study on the Genetics of Alcoholism (COGA), a large, ongoing family-based study that includes subjects from seven sites around the US. COGA has gathered detailed, standardized data on study participants, including diagnostic and neurophysiological assessments. This project has already proved successful in identifying several genes that influence the risk for alcoholism and neurophysiological endophenotypes, which have been independently replicated. COGA data were included as part of two Genetic Analysis Workshops, and the phenotypes are familiar to the genetics community. Alcoholic probands were recruited from treatment facilities, assessed by personal interview, and after securing permission, other family members were also assessed. A set of comparison families was drawn from the same communities as the families recruited through an alcoholic proband. Assessment involved a detailed personal interview developed for this project, the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), which gathers detailed information on alcoholism related symptoms along with other drugs and psychiatric symptoms. Many participants also came to the laboratories for electroencephalographic studies. Neurophysiological features that have been shown to be useful endophenotypes for which we have linkage and in some cases association results are included on a subset of the case-control sample: the beta power of the resting electroencephalogram (EEG), the P3(00) amplitude of the visual event-related potential (ERP), and the theta and delta event-related oscillations (EROs) underlying the P3.

  Study phs001208

• dbGaP Collection: Open Translational Science in Schizophrenia (OPTICS)

  Schizophrenia is a chronic, severe, disabling brain disorder that affects approximately 1% of the population worldwide. Epidemiologic studies have clearly demonstrated that genetics play a strong role in etiology, but the inheritance is very complex. Innovative analytic approaches and creative ways of combining disparate data sets will be necessary for making breakthroughs in identifying causal pathways and ultimately new drug targets. This dbGaP Collection consists of all genetic studies of schizophrenia available in dbGaP that have been consented for general research use. The goal is to facilitate identification of datasets with related scientific content in order to expedite the application process and ascertainment of datasets of interest for increased scientific discovery. The Open Translational Science in Schizophrenia (OPTICS) Project, was launched by Janssen Research & Development, LLC, part of the Janssen Pharmaceutical Companies of Johnson & Johnson, with a group of leading research organizations including the National Institutes of Health, Yale University School of Medicine, Rutgers University and the Harvard T.H. Chan School of Public Health, to create a new forum for collaborative analysis of Janssen's schizophrenia clinical trial data and other publicly available data about schizophrenia with the goal of creating new models for conducting research. The OPTICS project is one part of a larger effort at Janssen and other Johnson & Johnson research companies to share clinical trials data to enhance public health and advance science and medicine. Qualified investigators and physicians may apply for access to anonymized clinical trials data from Janssen, for more information please visit https://sites.google.com/site/opticsschizophrenia/.

  Study phs000887

• Organoid cultures of early-onset colorectal cancers reveal distinct and rare genetic profiles

  Sporadic early-onset colorectal cancer (EOCRC) has bad prognosis, yet is poorly represented by cell line models. We examine the key mutational and transcriptomic alterations in an organoid biobank enriched in EOCRCs. We established paired cancer (n=32) and normal organoids (n=18) from 20 patients enriched in microsatellite-stable EOCRC. Exome and transcriptome analysis was performed. We observed a striking diversity of molecular phenotypes, including PTPRK-RSPO3 fusions. Transcriptionally, RSPO fusion organoids resembled normal colon organoids and were distinct from APC mutant organoids, with high BMP2 and low PTK7 expression. Single cell transcriptome analysis confirmed the similarity between RSPO fusion organoids and normal organoids, with a propensity for maturation on Wnt withdrawal, whereas the APC mutant organoids were locked in progenitor stages. CRISPR/Cas9 engineered mutation of APC in normal human colon organoids led to upregulation of PTK7 protein and suppression of BMP2, but less so with an engineered RNF43 mutation. The frequent co-occurrence of RSPO fusions with SMAD4 or BMPR1A mutation was confirmed in TCGA database searches. RNF43 mutation was found in organoid from a leukaemia survivor with a novel mutational signature; and organoids with POLE proofreading mutation displayed ultramutation. The cancer organoid genomes were stable over long culture periods, while normal human colon organoids tended to be subject to clonal dominance over time. These organoid models enriched in EOCRCs with linked genomic data fill a gap in existing CRC models and reveal distinct genetic profiles and novel pathway cooperativity.

  Study EGAS00001004063

• Single cell RNA-seq mapping of nasal and tracheobronchial airways in human healthy volunteers

  The respiratory tract constitutes an elaborated line of defense based on a unique cellular ecosystem. Single-cell profiling methods enable the investigation of cell population distributions and transcriptional changes along the airways. We have explored cellular heterogeneity of the human airway epithelium in 10 healthy living volunteers by single-cell RNA profiling. 77,969 cells were collected by bronchoscopy at 35 distinct locations, from the nose to the 12th division of the airway tree. The resulting atlas is composed of a high percentage of epithelial cells (89.1%), but also immune (6.2%) and stromal (4.7%) cells with peculiar cellular proportions in different sites of the airways. It reveals differential gene expression between identical cell types (suprabasal, secretory, and multiciliated cells) from the nose (MUC4, PI3, SIX3) and tracheobronchial (SCGB1A1, TFF3) airways. By contrast, cell-type specific gene expression was stable across all tracheobronchial samples. Our atlas improves the description of ionocytes, pulmonary neuro-endocrine (PNEC) and brush cells, which are likely derived from a common population of precursor cells. We also report a population of KRT13 positive cells with a high percentage of dividing cells which are reminiscent of “hillock” cells previously described in mouse. Robust characterization of this unprecedented large single-cell cohort establishes an important resource for future investigations. The precise description of the continuum existing from nasal epithelium to successive divisions of lung airways and the stable gene expression profile of these regions better defines conditions under which relevant tracheobronchial proxies of human respiratory diseases can be developed.

  Study EGAS00001004082

• UK10K NEURO FSZNK

  In the UK10K project we propose a series of complementary genetic approaches to find new low frequency/rare variants contributing to disease phenotypes. These will be based on obtaining the genome wide sequence of 4000 samples from the TwinsUK and ALSPAC cohorts (at 6x sequence coverage), and the exome sequence (protein coding regions and related conserved sequence) of 6000 samples selected for extreme phenotypes. Our studies will focus primarily on cardiovascular-related quantitative traits, obesity and related metabolic traits, neurodevelopmental disorders and a limited number of extreme clinical phenotypes that will provide proof-of-concept for future familial trait sequencing. We will analyse directly quantitative traits in the cohorts and the selected traits in the extreme samples, and also use imputation down to 0.1% allele frequency to extend the analyses to further sample sets with genome wide genotype data. In each case we will investigate indels and larger structural variants as well as SNPs, and use statistical methods that combine rare variants in a locus or pathway as well as single-variant approaches. This Finnish schizophrenia sample set has been collected from a population cohort using national registers. The entire sample collection consists of 2756 individuals from 458 families of whom 931 are diagnosed with schizophrenia spectrum disorder. Families outside Kuusamo (n=288) all had at least two affected siblings. All diagnoses are based on DSM-IV and for a large fraction of cases there is cognitive data.For further details/descriptions with regard to this data set please contact Tiina Paunio (tiina.paunio@thl.fi)

  Study EGAS00001000119