17491 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 44.78 milliseconds.

• SF11215 snATAC Seq GBM

  High grade glioma sample, Gender Male Age 46. Single Nuclei ATAC seq data from high grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005407

• SF11331 snATAC Seq Primary GBM Male

  SF11331 Primary GBM Male,55 Single Nuclei ATAC seq data from high grade human glioma sample. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005408

• SF11612 scRNA-Seq Recurrent oligodendroglioma

  Single Cell RNA seq from Recurrent oligodendroglioma sample. Gender Male Age 67. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference through Cellranger count (10xGenomics.)

  Dataset EGAD00001005411

• SF11612 snATAC Seq Recurrent oligodendroglioma

  SF11612 Recurrent oligodendroglioma. Gender Male Age 67. Single Nuclei ATAC seq data from low grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005413

• SF9259S snRNA-Seq Primary GBM

  Single Nuceli Primary GBM 73 Male. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005428

• Multi-region sequencing of a RET fusion positive cancer patient

  Deep WGS sequencing (160x) of 2 different sites of disease of a patient with a RET fusion positive cancer. Amplicon sequencing of 19 other sites of the same patients for the RET fusion.

  Dataset EGAD00001005776

• combined ChIPseq (H3, modifications and TF)

  ChIPseq data for 31 CLL samples (12 controls, 19 tumor) of the CancerEpiSys-PRECiSe project; containing histone H3, histone modifications and transcription factor binding sites (CTCF, EBF1).

  Dataset EGAD00001005969

• Blood plasma and paired genomic DNA from neuroblastoma patients

  The dataset is comprised of 3 blood plasma samples (Patient 1-3_plasma_cfDNA) paired with genomic DNA (Patient 1-3_tumor gDNA) from the corresponding primary neuroblastoma from three patients. For all these samples whole-exome sequencing (WES) data have been generated.

  Dataset EGAD00001006012

• Leiomyosarcoma RNA-Seq

  RNA was extracted from fresh frozen LMS material for 29 untreated tumors (24 primary tumors, 5 metastatic12 relapses) and 13 tumors treated with radiation(7 primaries, 6 metastatic relapses). RNA-Seq sequencing was performed using established protocols on Illumina HiSeq 2500

  Dataset EGAD00001006628

• Fecal 16S rRNA gene sequencing

  Human fecal 16S rRNA gene sequencing data from patients treated with combined anti-CTLA-4 and anti-PD-1 immunotherapy for advanced melanoma.

  Dataset EGAD00001006735

• CASCADE Metastatic Melanoma Rapid Autopsy sequencing data

  Sequence data (paired-end FASTQ format) for 209 samples from 73 sample sites, from 7 individuals. Samples include primary melanomas, metastatic tumours and ctDNA

  Dataset EGAD00001006867

• PacBio HiFi sequencing of telobait-captured DNA from 48 patients

  PacBio HiFi sequencing was performed on 48 barcoded patients' genomic DNA after a telobait-capture protocol to enrich for telomeric regions. The sequencing reads of each patient were de-multiplexed and presented as patient-specific PacBio CCS BAM files.

  Dataset EGAD00001008626

• WGS data subfolder for normal tissue from multifocal ileal NETs study

  This dataset includes linked-read whole-genome sequencing data from the normal ileal of the patient. The normal sample was sequenced using the 10x Genomics linked-read whole-genome sequencing (WGS) approach.

  Dataset EGAD00001008491

• OAK biomarker data

  Additional relevant biomarker data for OAK including PD-L1 tumor cell IHC by the 22C3 assay, tumor mutational burden status, and STK11, KEAP1, and EGFR mutation status.

  Dataset EGAD00001008550

• Ampliseq library database

  This database contains 46 samples for early stage ovarian high grade serous carcinoma project. Amplicon sequencing on 37 tumour samples from early stage ovarian high grade serous carcinoma as well as 5 adjacent normal tissue samples and 4 whole blood samples.

  Dataset EGAD00001008587

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Transcriptome Analysis of CLL patient samples

  This dataset includes Illumina RNA Sequencing Data for 59 chronic lymphocytic leukemia patient samples. 57 samples are single end, 2 samples are paired end sequencing.

  Dataset EGAD00001008320

• CBD-RAW-RNASEQ: Bulk RNAseq data

  Bulk RNAseq data from whole blood. For further information regarding this dataset, please contact Katie Burnham and Andew Kwok at contact@combat.ox.ac.uk.

  Dataset EGAD00001007957

• CBD-RAW-SC-ATAC: 10X Single-Cell ATAC

  Raw Illumina sequencing data from single-cell ATACSeq experiments. For further information regarding this dataset, please contact Julian Knight and Tatjana Sauka-Spengler at contact@combat.ox.ac.uk.

  Dataset EGAD00001007963

• CBD-RAW-SC-VDJ-B: 10X Single-Cell VDJ BCR

  Raw Illumina sequencing data. For further information regarding this dataset, please contact Rachael Bashford-Rogers at contact@combat.ox.ac.uk.

  Dataset EGAD00001007964

• Dataset for LCPlus_WGS

  WES/WGS sequencing data of 56 chromothriptic tumor and control runs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001009275

• CITE-Seq (Cellular Indexing of Transcriptomes and Epitopes by Sequencing) of CLL_24

  To explore intratumor-heterogeneity of CLL_24 using single-cell multi-omics approach, we generated single-cell CITE-seq data for CLL_24, coupling scRNA-seq and protein surface marker measurements with oligo-tagged antibodies.

  Dataset EGAD00001009174

• Raw count matrix for 418 baseline samples

  Count matrix from 418 pre-treatment (Ven-Obi or Clb-Obi) CD19+ B cells

  Dataset EGAD00001009501

• sWGS of cfDNA from metastatic CRC patients

  Paired end shallow whole genome sequencing (sWGS) data (FASTQ) for the identification of genomewide somatic copy number alterations (SCNA) and the estimation of tumor fractions.

  Dataset EGAD00001010293

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• CFTR Gene Variant Detection in Moroccan Individuals via Nanopore Long-Read Sequencing

  This study consists of sequencing the whole CFTR gene (coding and non-coding regions) using Oxford Nanopore on Moroccan CF patients

  Study EGAS50000001423

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  This dataset is related to the NeoBCC trial and includes 12 human tissue samples

  Dataset EGAD50000000371

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• APCIM_Nanostring_HD

  Expression of immune related genes in 12 healthy donors. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002554

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• multi-region sequencing of tumor samples from PDAC patients

  This study includes 542 of multi-region sampled whole exome sequencing data from 83 pancreatic cancer patients in 6 individual experiments : Kras wildtype, local recurrence, treatment-naive (MetomeV2), radiotherapy plus chemotherapy (Radome), chemotherapy-only group (Treatome) and Proj_B-100-478.

  Dataset EGAD00001011109

• RNA-seq data of patients with glioblastoma IDH-wt (CNS WHO grade 4) with matched primary and relapse samples.

  Between January 1st, 2016, and December 31th, 2021, patients with glioblastoma IDH-wt (CNS WHO grade 4) were included. RNA-seq was performed in a subset of patients.

  Dataset EGAD00001015683

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• HERBY trial RNASeq

  RNA sequencing of non-brainstem paediatric high grade glioma from the HERBY phase II randomised trial. RNA from fresh frozen surgical tissue in 20 cases was subjected to Illumina whole transcriptome paired end sequencing. Data is provided as paired-end FASTQ files

  Dataset EGAD00001004070