16139 results for "free fc coins and points Visit Buyfc26coins.com Alennukset toistuvista ostoista..p4v2"

in 27.18 milliseconds.

• Tumorigenic role of Musashi-2 in aggressive mantle cell lymphoma

  SOX11 is overexpressed in the highly aggressive conventional mantle cell lymphoma (MCL) but rarely in the indolent non-nodal MCL subtype. We performed RNA-seq of SOX11+ and SOX11- MCLs to search for SOX11-regulated genes that contributed to MCL clinical evolution, identifying Musashi-2 (MSI2) stem cell-related gene. By performing RNA-seq upon MSI2 knockdown or inhibition in MCL, we identified MSI2 as a potential target to inhibit drug resistance in aggressive MCLs.

  Study EGAS00001006613

• IMCISION RNAseq

  RNA sequencing of 32 primary head and neck squamous cell carcinoma (HNSCC) samples prior to treatment with neoadjuvant anti-PD-1 (n=6) or anti-PD-1 + anti-CTLA-4 (n=26) immunotherapy, and 30 paired on-treatment HNSCC samples (i.e. after neoadjuvant immunotherapy). RNA quantity used: 10ng. Library Preparation Kit: SMART Stranded Total RNA Seq Kit (Takara). Sequencing parameters: NovaSeq 6000, 2x 100 bp. File type: fastQ

  Dataset EGAD00001008127

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• COVID-19 Severity First Wave of Infection for Severe Patients in Madrid

  We recruited 98 hospitalised patients displaying severe COVID-19 symptoms from the first wave of infection. A stringent exclusion criteria based on non-genetic factors such as age, blood oxygen, radiologic findings and other typical COVID-19 signs was performed. Gingival or peripheral blood samples were taken for 98 individuals and whole exome sequencing performed using ExomeCapture-Seq capture KAPA HyperExome on Illumina machines.

  Dataset EGAD00001008464

• RNA-seq of high-grade serous ovarian cancer in long-term survivors (MOCOG study)

  RNA-seq dataset of high-grade serous ovarian cancer (HGSC) tumours from long-term survivors performed as part of the Multidisciplinary Ovarian Cancer Outcomes Group (MOCOG) study. The dataset includes fastq files from 56 HGSC tumours (53 primary tumours and 3 recurrent tumours) from 53 long-term survivor patients. Libraries were generated using the Illumina Stranded mRNA Prep and 150 bp paired-end sequencing was performed to a minimum of 100 million reads on Illumina NovaSeq 6000 instruments.

  Dataset EGAD00001008537

• scEC&T-seq manuscript data

  This dataset includes all data produced in the study describing "scEC&T-seq", a method for parallel sequencing of extrachromosomal circular DNA and transcriptome in single cells. This dataset includes: - Illumina scEC&T-seq Circle-seq data (scCircle-seq) for a total of 626 single cells / nuclei - bam files - Illumina scEC&T-seq RNA-seq data (scRNA-seq-Illumina) for the same single cells / nuclei - bam files - Nanopore scCircle-seq data for 18 single cells - bam files - Nanopore bulk WGS for 2 cell lines and 2 primary tumor samples - bam files - Illumina bulk WGS for 2 cell lines - bam files - Illumina bulk Circle-seq data from 1 cell line - bam file - Illumina ChIP-seq H3K27me3 data from 1 cell line - fasta files + peaks bed file + coverage bw file

  Dataset EGAD00001010071

• Somatic L1 retrotransposition in normal colorectal epthelium

  Throughout an individual’s lifetime, genomic alterations accumulate in somatic cells. However, the mutational landscape induced by retrotransposition of long interspersed nuclear element-1 (L1), a widespread mobile element in the human genome, is poorly understood in normal cells. Here, we explored the whole-genome sequences of 406 normal colorectal clones, 12 MUTYH-associated adenomatous clones, and 19 matched colorectal cancer tissues. In addition, we analyzed promoter DNA methylation status of retrotransposition-competent L1 (in 139 clones) and read-through RNA expression profiles (in 116 clones) to investigate the epigenetic regulation of L1 activity.

  Dataset EGAD00001010183

• Rare Disease Synthetic Dataset

  The purpose of this project is to provide public human datasets for the study of rare diseases. The use of public human genomic background combined with the in-silico insertion of real disease-causing variants enable to have a representative dataset for testing purposes without facing ethical and legal issues associated with the use of human sensitive data. This project aims to help development of technical implementations for rare disease data integration, analysis, discovery, and federated access.

  Dataset EGAD00001008392

• Cancer-independent, second somatic NF1 mutation of normal tissues in neurofibromatosis type 1

  Cancer predisposition syndromes mediated by recessive cancer genes generate tumours via somatic variants (second hits) in the unaffected allele. Second hits may or may not be sufficient for neoplastic transformation. Here, we performed whole genome and exome sequencing on 479 tissue biopsies from a child with neurofibromatosis type 1, a multi-system cancer-predisposing syndrome mediated by constitutive monoallelic NF1 inactivation. We identified multiple independent NF1 driver variants in histologically normal tissues, but not in 610 biopsies from two non-predisposed children. We corroborated this finding using targeted duplex sequencing, including a further nine adults with the same syndrome. Overall, truncating NF1 mutations were under positive selection in normal tissues from individuals with neurofibromatosis type 1. We demonstrate that normal tissues in neurofibromatosis type 1 commonly harbour second hits in NF1, the extent and pattern of which may underpin the syndrome's cancer phenotype.

  Dataset EGAD00001015398

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Single-cell RNA sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell RNA sequencing (scRNA-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007015

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. It seems plausible that rates of implantation would improve if we had a better understanding of molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to identify candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Dataset EGAD00001005044

• Effects of busulfan, fludarabine and clofarabine treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to chemotherapy-induced toxicity due to its high epithelial proliferative rate, making gut toxicity an off-target effect in several cancer treatments, including conditioning regimens for allogeneic hematopoietic cell transplantation (HSCT). In HSCT, intestinal damage is an important factor in the development of Graft-versus-Host Disease (GVHD), an immune complication in which donor immune cells attack the recipient's tissues. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of chemotherapy-induced intestinal epithelial damage at the RNA level. We show that chemotherapy conditioning specifically reprograms the intestinal epithelial transcriptome after treatment with either busulfan (3.5μM), fludarabine (15μM) or clofarabine (0.5μM) for 24h. This knowledge can potentially enable us to understand which changes undergo in healthy tissues upon conditioning and how those are related with immune activation typical in GVHD.

  Study EGAS00001007550

• Tracking the evolution of esophageal squamous cell carcinoma under dynamic immune selection by multi-omics sequencing

  Intratumoral heterogeneity (ITH) has been linked to decreased efficacy of clinical treatments. However, although genomic ITH has been characterized in genetic, transcriptomic and epigenetic alterations are hallmarks of esophageal squamous cell carcinoma (ESCC), the extent to which these are heterogeneous in ESCC has not been explored in a unified framework. Further, the extent to which tumor-infiltrated T lymphocytes (TILs) are directed against cancer cells, but how the immune infiltration acts as a selective force to shape the clonal evolution of ESCC is unclear. In this study, we perform multi-omic sequencing on 186 samples from 36 primary ESCC patients. Through multi-omics analyses, it is discovered that genomic, epigenomic, and transcriptomic ITH are underpinned by ongoing chromosomal instability. Based on the RNA-seq data, we observe diverse levels of immune infiltrate across different tumor sites from the same tumor. We reveal genetic mechanisms of neoantigen evasion under distinct selection pressure from the diverse immune microenvironment. Overall, our work offers an avenue of dissecting the complex contribution of the multi-omics level to the ITH in ESCC and thereby enhances the development of clinical therapy.

  Dataset EGAD00001009482

• Molecular risk stratification in patients with T1 colorectal cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have 'born-to-be-bad' aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world's largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3' RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Dataset EGAD00001010890

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Pakistan_Damgaard2018

  Genotype data for 140 present-day individuals from five populations in Pakistan in The first horse herders and the impact of early Bronze Age steppe expansions into Asia DOI: 10.1126/science.aar7711. Sampling details are presented in supplementary section S2.1 Data generation

  Dataset EGAD00010001678

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• cytogenetically visibile inversions

  Pacbio Hifi whole genome sequencing data from six individuals carrying cytogenetically visible inversions. The HiFi data was produced on the PacBio Revio machine, using 1 flowcell per sample. The resulting data was aligned to hg19 using minimap2, and converted into bam using samtools.

  Dataset EGAD50000000635

• Raw ONT R10 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 207 samples sequenced using rapid-multiplexed barcoded library preparation on Nanopore PromethION R10 flow cells on P2 Solo and P24 systems. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000791

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• Tumor Profiler Project - AML bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000822

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• DDD-Africa Exome Sequencing

  1230 participants from both South Africa and The Democratic Republic of Congo underwent whole exome sequencing on an Illumina NovaSeq 6000 at Wellcome Trust Sanger Institute.

  Dataset EGAD00001015728

• Dataset for desmoplastic small round cell tumor - WGS

  This dataset contains 25 WGS sequencing samples of patients with desmoplastic small round cell tumor. Sequencing was performed on Illumina HiSeq X and NovaSeq 6000 using Illumina TruSeq Nano DNA Kit. The sequencing was always paired.

  Dataset EGAD50000000911

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129