16238 results for "free fc coins and points Visit Buyfc26coins.com Alennukset toistuvista ostoista..p4v2"

in 27.25 milliseconds.

• Rare Disease Synthetic Dataset

  The purpose of this project is to provide public human datasets for the study of rare diseases. The use of public human genomic background combined with the in-silico insertion of real disease-causing variants enable to have a representative dataset for testing purposes without facing ethical and legal issues associated with the use of human sensitive data. This project aims to help development of technical implementations for rare disease data integration, analysis, discovery, and federated access.

  Dataset EGAD00001008392

• ctDNA multigenic panel for non-small cell lung cancer

  Detection of actionable mutations in liquid biopsies constitute an important tool for management of non-small cell lung cancer (NSCLC) patients in the era of oncology precision medicine. We aimed to evaluate the actionable alterations using a commercial multi-gene panel in circulating tumor DNA (ctDNA) derived from plasma samples of treatment naïve and prior-treated non-small cell lung cancer (NSCLC) patients. For this, we analyze plasma samples of 30 subjects with non-small cell lung cancer.

  Study EGAS50000000643

• Cancer-independent, second somatic NF1 mutation of normal tissues in neurofibromatosis type 1

  Cancer predisposition syndromes mediated by recessive cancer genes generate tumours via somatic variants (second hits) in the unaffected allele. Second hits may or may not be sufficient for neoplastic transformation. Here, we performed whole genome and exome sequencing on 479 tissue biopsies from a child with neurofibromatosis type 1, a multi-system cancer-predisposing syndrome mediated by constitutive monoallelic NF1 inactivation. We identified multiple independent NF1 driver variants in histologically normal tissues, but not in 610 biopsies from two non-predisposed children. We corroborated this finding using targeted duplex sequencing, including a further nine adults with the same syndrome. Overall, truncating NF1 mutations were under positive selection in normal tissues from individuals with neurofibromatosis type 1. We demonstrate that normal tissues in neurofibromatosis type 1 commonly harbour second hits in NF1, the extent and pattern of which may underpin the syndrome's cancer phenotype.

  Dataset EGAD00001015398

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Single-cell RNA sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell RNA sequencing (scRNA-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007015

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Pakistan_Damgaard2018

  Genotype data for 140 present-day individuals from five populations in Pakistan in The first horse herders and the impact of early Bronze Age steppe expansions into Asia DOI: 10.1126/science.aar7711. Sampling details are presented in supplementary section S2.1 Data generation

  Dataset EGAD00010001678

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• cytogenetically visibile inversions

  Pacbio Hifi whole genome sequencing data from six individuals carrying cytogenetically visible inversions. The HiFi data was produced on the PacBio Revio machine, using 1 flowcell per sample. The resulting data was aligned to hg19 using minimap2, and converted into bam using samtools.

  Dataset EGAD50000000635

• Raw ONT R10 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 207 samples sequenced using rapid-multiplexed barcoded library preparation on Nanopore PromethION R10 flow cells on P2 Solo and P24 systems. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000791

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• Tumor Profiler Project - AML bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000822

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• DDD-Africa Exome Sequencing

  1230 participants from both South Africa and The Democratic Republic of Congo underwent whole exome sequencing on an Illumina NovaSeq 6000 at Wellcome Trust Sanger Institute.

  Dataset EGAD00001015728

• Dataset for desmoplastic small round cell tumor - WGS

  This dataset contains 25 WGS sequencing samples of patients with desmoplastic small round cell tumor. Sequencing was performed on Illumina HiSeq X and NovaSeq 6000 using Illumina TruSeq Nano DNA Kit. The sequencing was always paired.

  Dataset EGAD50000000911

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• Bulk RNASeq of metastatic colorectal cancer organoids with ATOH1 knockout

  Bulk RNA sequencing was performed on mCRC organoids subjected to cetuximab treatment, comparing ATOH1 knockout and control conditions. The dataset is intended to elucidate the contribution of ATOH1-regulated secretory cell population to cetuximab persistence mechanisms.

  Dataset EGAD50000002060

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• SEF tumor sequencing data

  This dataset contains samples from 8 patients with Sclerosing epithelioid fibrosarcoma. All 8 samples have whole exome tumor data and tumor RNAseq data. 3 samples also have matched normal dna sequence data.

  Dataset EGAD00001011100

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604