16784 results for "sec+and+unspecified+malignant+neoplasm"

in 23.17 milliseconds.

• Data Use Ontology (DUO)

  Data Use Ontology Data Use Ontology at EGA The EGA is committed to its involvement in the work of GA4GH. In an effort to enhance data discoverability and streamline data access, EGA have implemented the use of the Data Use Ontology (DUO), based on consent codes as described in Dyke et al. 2017. The Data Use Ontology codes will be displayed on the live dataset page of your submission to advise any would be requestor on how the data can be used and also to enhance data discoverability as users will be able to search on these codes to find applicable datasets. DUO can be browsed online via the Ontology Lookup Service Learn more reading the Data Use Ontology publication and the GA4GH Machine-Readable Consent Guidance! Check our DAC Portal Take The Tour and learn how to add DUO codes to your policy! Term Shorthand Label Description DUO:0000004 NRES no restriction This data use permission indicates there is no restriction on use. DUO:0000042 GRU general research use This data use permission indicates that use is allowed for general research use for any research purpose. DUO:0000006 HMB health or medical or biomedical research This data use permission indicates that use is allowed for health/medical/biomedical purposes; does not include the study of population origins or ancestry. DUO:0000007 DS disease specific research This data use permission indicates that use is allowed provided it is related to the specified disease. DUO:0000011 POA population origins or ancestry research only This data use permission indicates that use of the data is limited to the study of population origins or ancestry. DUO:0000012 RS research specific restrictions This data use modifier indicates that use is limited to studies of a certain research type. DUO:0000015 NMDS no general methods research This data use modifier indicates that use does not allow methods development research (e.g., development of software or algorithms). DUO:0000016 GSO genetic studies only This data use modifier indicates that use is limited to genetic studies only (i.e., studies that include genotype research alone or both genotype and phenotype research, but not phenotype research exclusively) DUO:0000018 NPUNCU not for profit, non commercial use only This data use modifier indicates that use of the data is limited to not-for-profit organizations and not-for-profit use, non-commercial use. DUO:0000019 PUB publication required This data use modifier indicates that requestor agrees to make results of studies using the data available to the larger scientific community. DUO:0000020 COL collaboration required This data use modifier indicates that the requestor must agree to collaboration with the primary study investigator(s). DUO:0000021 IRB ethics approval required This data use modifier indicates that the requestor must provide documentation of local IRB/ERB approval. DUO:0000022 GS geographical restriction This data use modifier indicates that use is limited to within a specific geographic region. DUO:0000024 MOR publication moratorium This data use modifier indicates that requestor agrees not to publish results of studies until a specific date. DUO:0000025 TS time limit on use This data use modifier indicates that use is approved for a specific number of months. DUO:0000026 US user specific restriction This data use modifier indicates that use is limited to use by approved users. DUO:0000027 PS project specific restriction This data use modifier indicates that use is limited to use within an approved project. DUO:0000028 IS institution specific restriction This data use modifier indicates that use is limited to use within an approved institution. DUO:0000029 RTN return to database or resource This data use modifier indicates that the requestor must return derived/enriched data to the database/resource. DUO:0000043 CC clinical care use This data use modifier indicates that use is allowed for clinical use and care. DUO:0000044 NPOA population origins or ancestry research prohibited This data use modifier indicates use for purposes of population, origin, or ancestry research is prohibited. DUO:0000045 NPU not for profit organisation use only This data use modifier indicates that use of the data is limited to not-for-profit organisations. DUO:0000046 NCU non-commercial use only This data use modifier indicates that use of the data is limited to not-for-profit use. Point to Notice: For the consent code DUO:0000007 where data is restricted to use on a specific disease, please accompany it with an appropriate ontology from MONDO e.g., If the data is restricted to the use of research into juvenile idiopathic arthritis the code should be displayed as DUO:0000007; MONDO:0011429.

  Documentation access/data-access-committee/data-use-ontology

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818