21170 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 35.64 milliseconds.

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• Human normal brain bulk RNA-seq

  We profiled 43 normal human adult brain and 11 normal human fetal brain specimens by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001005130

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• Whole genome sequencing of the healthy breast

  Whole genome sequencing of 29 donors of healthy mammary tissue. BAM files of stromal and epithelial DNA are included.

  Dataset EGAD00001006402

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• Transcriptome analysis of human muscle/myofibers carrying the human nemaline myopathy type 6-associated KBTBD13-R408C variant.

  This dataset contains mRNA-seq results from eleven samples from human donors, each sample being composed of 5-10 rebulked fiber type-specific myofibers. This sample set includes; 1) Three FT-I and three FT-IIa rebulked samples from control individuals 2) Three FT-I and two FT-IIa rebulked samples from NEM6 patients with a KBTBD13R408C variant (NP_001094832.1: p.Arg408Cys)

  Dataset EGAD50000002408

• Sequencing data from the study "Somatic rearrangements causing oncogenic ectodomain deletions of FGFR1 in squamous cell lung cancer"

  This dataset consists of 71 whole-genome samples and 47 RNA-seq samples. All WGS samples are provided in .bam format and RNA-seq samples are provided as .fq.gz (paired-end). Next-generation sequencing data on whole genomes were processed by aligning sequencing reads to a reference genome (NCBI build 37/hg19) using bwa-mem (0.7.13-r1126).

  Dataset EGAD50000001978

• Human Single-Oocyte Transcriptome - Control and Cannabis Treated

  RNAseq data of human single oocytes exposed to THC and its metabolites, (mean concentration measured in the follicular fluid, THC1, n=95, 25 ng/mL Δ9-THC, 5 ng/mL 11-OH-THC, 50 ng/mL 11-COOH-THC) or a supraphysiologic, THC2, n=93, 100 ng/mL Δ9-THC, 50 ng/mL 11-OH-THC, 200 ng/mL 11-COOH-THC).

  Dataset EGAD50000001534

• RNA-seq dataset

  RNA-seq data from CD20+ sorted cells obtained from peripheral blood and lymph node Follicular Lymphoma patients. These samples were unstimulated after thawing and additionally, peripheral blood samples were stimulated during 7 days in culture as described in Dobaño-López C et al. Stranded RNA-seq libraries were performed using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD50000000347

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005762

• Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient

  Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005763

• Stage-specific gene and transcript dynamics in human male germ cells

  To study global transcriptional dynamics during human spermatogenesis we sequenced total RNA of human testicular biopsies with 5 specific histological phenotypes: Sertoli cell-only (SCO, n=3), spermatogenic arrests at the spermatogonial (SPG, n=4), spermatocyte (SPC, n=3), and spermatid (SPD, n=3) level, as well as normal spermatogenesis (Normal, n=3).

  Dataset EGAD00001008652

• Single-cell whole-genome sequencing of matched primary GBM tumours and patient-derived organoids

  Single-cell whole-genome sequencing of primary GBM tumours and matched patient-derived organoids. Obtained using the 10X Genomics single-cell CNV solution. Samples from two spatially distinct regions of five tumours from three patients (three primary, two recurrent).

  Dataset EGAD00001007937

• Genome and transcriptome sequence data from an unspecified tissue chordoma patient

  Genome and transcriptome sequence data from an unspecified tissue chordoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008013

• Prostate cancer m6A epitranscriptome

  Using meRIP-sequencing, we profiled N-6 methyladenosine (m6A) in a cohort of 148 primary prostate cancer samples as part of the Canadian Prostate Cancer Genome Network project (CPC-GENE). Paired-end sequencing of 150 bp reads were mapped to GRCh38.p13 using annotations from gencode.v34.chr_patch_hapl_scaff.annotation.gtf. Peaks were called using MeTPeak, joint peaks were identified and IP reads were quantitated, normalized and adjusted using Input reads to obtain estimates of m6A abundance.

  Dataset EGAD00001009869

• Whole Genome Sequencing of Head and Neck Angiosarcoma

  This dataset contains 55 Whole Genome Sequencing of the study titled Spatial transcriptomics reveal topological immune landscapes of Asian head and neck angiosarcoma.

  Dataset EGAD00001010140

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010315

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010318

• ATAC-seq and RNA-seq datasets of CD14+ monocytes from healthy donors

  This dataset consists of functional genomic data from 6 healthy donors taken from CD14+ monocytes upon different immune stimulations. It contains 150 paired end fastq files consisting of 30 total RNA-seq samples across 4 runs and 30 ATAC-seq samples. The samples were sequenced on Illumina HiSeq4000 platform.

  Dataset EGAD00001011113

• Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient

  Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient,generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001015583

• Single-cell analysis of matched FFPE and frozen tissue samples reveals comparable resolution of intratumoural heterogeneity

  Testing the differences between FFPE and fresh frozen derived single cell results.

  Dataset EGAD00001015781

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  Study EGAS00001000752

• Fragment ends of circulating microbial DNA as signatures for infectious diseases

  Fragment ends of circulating microbial DNA as signatures for infectious diseases

  Study EGAS00001006321

• CHILD Study Dataset

  This data set contains the CRAM files for the samples in the CHILD cohort, sequenced on the Illumina HiSeq X platform.

  Dataset EGAD00001009710

• RNA-seq of granulosa cells from 8 IVF patients in two age groups

  This dataset contains raw sequencing data of mRNA from granulosa cell samples from 8 human patients undergoing in vitro fertilization. All patients were normal responders referred for male infertility and were grouped into two age groups (younger than 31 or older than 38 years old). Each sample contains all granulosa cells collected from one patient on one collection date. Raw sequencing fastq files are available in this dataset, count tables are available in ArrayExpress (E-MTAB-13496).

  Dataset EGAD50000001210

• Sequencing data for oesophageal and related samples - BOs release 4 (RNA)

  Dataset EGAD00001004023

• Sequencing data for oesophageal and related samples - Mourikis et al (WGS)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. WGS (BAM files) 521 samples

  Dataset EGAD00001004775

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Dataset for COPD human sputum 16S rRNA gene sequencing data

  Dataset for 16S rRNA gene sequencing data for sputum samples 61 COPD patients, generated using PacBio sequencing technology.

  Dataset EGAD00001009103

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853