19229 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 33.65 milliseconds.

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95624A

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 604 samples; filetype=bam

  Dataset EGAD00001004747

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95632B

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 626 samples; filetype=bam

  Dataset EGAD00001004748

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95632D

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 635 samples; filetype=bam

  Dataset EGAD00001004749

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95660A

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 1522 samples; filetype=bam

  Dataset EGAD00001004750

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95664A

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 465 samples; filetype=bam

  Dataset EGAD00001004751

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• scRNA-seq and scTCR-seq from 7 MF patients

  Dataset containing scRNA and scTCR sequencing of 7 patients with cutaneous T cell lymphoma. Sequencing was performed on Illumina NextSeq 550, HiSeq 4000 and NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD50000000332

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• thraruk-G-1

  Resolving the Genetic Architecture of Aseptic Loosening After Total Hip Replacement

  Dataset EGAD00010001289

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Plasma cell-free whole genome sequencing

  This dataset contains whole genome sequencing data generated from plasma cell-free DNA of metastatic breast cancer patients and healthy individuals. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002524

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• RNA-seq explants chondrocytes

  Osteochondral explants were obtained from knee joints (n=17 explants) from the RAAK study. Paired-end 2x150 bp RNA sequencing (Illumina TruSeq mRNA Library Prep Kit, Illumina HiSeq X) was performed.

  Dataset EGAD00001008752

• 17 skin and oral epithelial bulk samples from 2 donors

  Aligned BAM files with removed duplicate reads of targeted sequencing data (exomes of a panel of 153 genes) from 12 skin and 5 oral epithelial bulk samples from 2 donors. Sequences generated by the BGI DNB-SEQ platform.

  Dataset EGAD00001008956

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Paired WGS samples (tumor and control) of one Sarcoma case

  Paired WGS samples (tumor and control) of one Sarcoma case. The paired sequencing was done on Hiseq X Ten with Illlumina TruSeq Nano DNA.

  Dataset EGAD00001010277

• Mutation analysis of 77 genes in cfDNA from metastatic CRC patients

  Aligned NGS data (BAM) of 77 frequently mutated genes in cancer using the AVENIO Expanded platform.

  Dataset EGAD00001010294

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• RNA-Seq data of VDH15 cells with and without deletion of NSUN3

  paired RNA-Seq data of VDH15 cells with and without deletion of NSUN3. The 11 samples were sequenced on HiSeq 4000 and prepared with SmarTer low input RNA and Chip NEBNext kit.

  Dataset EGAD00001006560

• PMBCL sequencing - bam analysis

  Files associated with the dataset: HS1626.bam, HS1484.bam, HS1483.bam, HS1482.bam, HS1481.bam, HS1480.bam, HS1479.bam, HS1478.bam, A13805.bam, A13800.bam, A13799.bam, A05253.bam, A05252.bam, A13806.bam

  Dataset EGAD00001000692

• Uveal melanoma whole genome sequencing, SNP arrays and RNA-seq

  We conducted whole genome sequencing and DNA SNP array of 12 uveal melanoma genomes and their matched DNA from blood. We also conducted RNA-seq of the 12 tumour samples.

  Dataset EGAD00001000372

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Whole exome sequencing of 3 primary Plasma Cell Leukemia samples

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 3 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001005306