19375 results for "Cheap fc 26 coins Buyfc26coins.com is official EA Sports partner for FC 26 coins That was the fastest delivery ever..fxB4"

in 42.06 milliseconds.

• ICGC PCAWG Dataset: PRAD-UK_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PRAD-UK.

  Dataset EGAD00001002126

• ICGC PCAWG Dataset: PBCA-DE_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PBCA-DE.

  Dataset EGAD00001002127

• ICGC PCAWG Dataset: PRAD-CA_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PRAD-CA.

  Dataset EGAD00001002128

• ICGC PCAWG Dataset: BRCA-EU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: BRCA-EU.

  Dataset EGAD00001002129

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: CLLE-ES.

  Dataset EGAD00001002130

• ICGC PCAWG Dataset: RECA-EU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: RECA-EU.

  Dataset EGAD00001002131

• ICGC PCAWG Dataset: PACA-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PACA-AU.

  Dataset EGAD00001002132

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: LIRI-JP.

  Dataset EGAD00001002155

• ICGC PCAWG Dataset: ESAD-UK_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: ESAD-UK.

  Dataset EGAD00001002156

• ICGC PCAWG Dataset: PAEN-IT_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PAEN-IT.

  Dataset EGAD00001002153

• ICGC PCAWG Dataset: PAEN-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PAEN-AU.

  Dataset EGAD00001002154

• ICGC PCAWG Dataset: MELA-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: MELA-AU.

  Dataset EGAD00001002157

• RNAseq data

  Bulk RNAseq of sigmoid colon biopsies from healthy volunteers and ulcerative colitis patients. Subjects were treated with Placebo or IL-22Fc at different doses, and biopsies were collected at day 0 and day 30 post treatment and prepared for RNA sequencing.

  Dataset EGAD00001008816

• Fecal 16S UC sequencing data

  Fecal 16S-V4 rRNA gene sequence data from NCT02749630 ulcerative colitis patients. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing

  Dataset EGAD00001008818

• Fecal 16S HV sequencing data

  Fecal 16S-V4 rRNA gene sequence data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing

  Dataset EGAD00001008840

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• cfMethyl-Seq

  cfMethyl-Seq libraries were generated for 479 cfDNA samples and were sequenced with 150 bp paired-end reads.

  Dataset EGAD00001009003

• BC Cancer, part of the Provincial Health Services Authority, Technology Development Office, Data Access Committee (PHSA TDO DAC)

  Access to data generated by BCCA is made available by completing the data access agreement for review by the data access committee and will be granted to qualified investigators for appropriate use.

  Dac EGAC00000000011

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• thraruk-G-1

  Resolving the Genetic Architecture of Aseptic Loosening After Total Hip Replacement

  Dataset EGAD00010001289

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• RNA-Seq data of VDH15 cells with and without deletion of NSUN3

  paired RNA-Seq data of VDH15 cells with and without deletion of NSUN3. The 11 samples were sequenced on HiSeq 4000 and prepared with SmarTer low input RNA and Chip NEBNext kit.

  Dataset EGAD00001006560

• Whole Genome Sequencing of 18 sequential samples from 3 CLL patients

  Whole Genome Sequencing to track subclonal heterogeneity in 18 samples from 3 Chronic Lymphocytic Leukemia patients subjected to repeated cycles of therapy. NOTE: There are only 12 BAM files available to download. The other 6 files are missing.

  Dataset EGAD00001000972

• PMBCL sequencing - bam analysis

  Files associated with the dataset: HS1626.bam, HS1484.bam, HS1483.bam, HS1482.bam, HS1481.bam, HS1480.bam, HS1479.bam, HS1478.bam, A13805.bam, A13800.bam, A13799.bam, A05253.bam, A05252.bam, A13806.bam

  Dataset EGAD00001000692

• Uveal melanoma whole genome sequencing, SNP arrays and RNA-seq

  We conducted whole genome sequencing and DNA SNP array of 12 uveal melanoma genomes and their matched DNA from blood. We also conducted RNA-seq of the 12 tumour samples.

  Dataset EGAD00001000372

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Transcriptome analysis of Treg cells from blood, fat, liver and skin

  Tcells were isolated fom Tissues and FACS sorted. In total 43 samples were processed in 5 replicates with the Takara SmartSeq Stranded kit. Single end fastq-files are supplied.

  Dataset EGAD00001007664

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• Human tumor bulk RNA-seq

  We profiled 9 high-grade gliomas patient tumor samples by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001008348