3659 results for "RNA AND sequencing OR transcriptome"

in 16.11 milliseconds.

• BLUEPRINT release January 2015, RNA-Seq for class switched memory B cell

  RNA-Seq data for 1 class switched memory B cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001164

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - ATRA, on genome GRCh38

  RNA-Seq data for 3 Acute Promyelocytic Leukemia - ATRA sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002356

• BLUEPRINT release August 2016, RNA-Seq for mature eosinophil, on genome GRCh38

  RNA-Seq data for 2 mature eosinophil sample(s). 3 run(s), 3 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002326

• BLUEPRINT release August 2016, RNA-Seq for Acute Myeloid Leukemia - CTR, on genome GRCh38

  RNA-Seq data for 7 Acute Myeloid Leukemia - CTR sample(s). 7 run(s), 7 experiment(s), 7 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002443

• BLUEPRINT release August 2016, RNA-Seq for osteoclast, on genome GRCh38

  RNA-Seq data for 2 osteoclast sample(s). 2 run(s), 2 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002479

• RNA sequencing of primary B-cells infected with Epstein-Barr virus (EBV), treated with heat-inactivated EBV, CpG or BCR-crosslinking in presence or absence of Linrodostat

  B cells were isolated from buffy coat preparations of healthy donors using CD19 magnetic beads. B cells were then infected with EBV using spinoculation or activated with heat-inactivated EBV, respectively. Additionally cells were treated with 5ng/ml CpG or a BCR-crosslinking mixture in presence or absence of 10 µM Linrodostat (IDO1 inhibitor). RNA samples were isolated at 2 days post-infection / post-activation and one day 0 control with non-infected B cells was included.

  Dataset EGAD50000000306

• Hypothalamic transcriptome in Prader-Willi syndrome

  Transcriptional analysis of brain tissue from people with molecularly defined causes of obesity may highlight novel disease mechanisms and therapeutic targets. Prader-Willi syndrome (PWS) is a genetic obesity syndrome characterised by severe hyperphagia. We performed RNA sequencing of the hypothalamus from 4 individuals with PWS and 4 age-matched controls.

  Study EGAS00001002901

• Facioscapulohumeral dystrophy transcriptome signatures correlate with different stages of disease and are marked by different MRI biomarkers

  This project includes RNA-sequencing data from human FSHD and control skeletal muscle biopsies. This project includes data from 28 FSHD patients (total 37 samples, including vastus lateralis and tibialis anterior muscles) and 12 control individuals (total 24 samples, including vastus lateralis and tibialis anterior muscles).

  Study EGAS00001005782

• RNA sequencing of CD8 T cells from melanoma patients prior to and during checkpoint immunotherapy and untreated healthy controls

  We are interested in inter-individual variation in transcriptional response to immune checkpoint blockade. We have analysed poly A purified RNA expression from CD8 T cells (297 transcriptomes in total) isolated from metastatic melanoma patients (n=106) prior to and during treatment with either single agent (Pembrolizumab) or combination (Ipilimumab/ Nivolumab) immune checkpoint blockade. We compare expression at different stages of treatment and additionally contrast this with that from healthy controls (n=68).

  Dataset EGAD00001005973

• Custom long non-coding RNA capture enhances detection sensitivity in different human sample types.

  Long non-coding RNAs (lncRNAs) are a heterogeneous group of transcripts that lack protein coding potential and display regulatory functions in various cellular processes. As a result of their cell- and cancer-specific expression patterns, lncRNAs have emerged as potential diagnostic and therapeutic targets. The accurate characterization of lncRNAs in bulk transcriptome data remains challenging due to their low abundance compared to protein coding genes. To tackle this issue, we describe a unique short-read custom lncRNA capture sequencing approach that relies on a comprehensive set of 565,878 capture probes for 49,372 human lncRNA genes. This custom lncRNA capture approach was evaluated on various sample types ranging from artificial high-quality RNA mixtures to more challenging formalin-fixed paraffin-embedded tissue and biofluid material. The custom enrichment approach allows the detection of a more diverse repertoire of lncRNAs, with better reproducibility and higher coverage compared to classic total RNA-sequencing.

  Study EGAS00001005418

• MPM patients

  - RNA-sequencing data: 5 normal pleurae and 40 malignant pleural mesotheliomas - Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 6 MPM samples. 2 FASTQ files for each sample (paired).

  Dataset EGAD00001008740

• Dataset of Master Samples submitted to other HIPO projects

  RNA-Seq, WES and WGS data of 5 rare tumor/control pairs which were submitted to other HIPO projects, not MASTER. The sequencing was always paired.

  Dataset EGAD00001008905

• TN

  In order to comprehensively investigate the genetic relationship between PTC tumors and benign nodules, we totally collected 127 fresh-frozen biopsies samples from 28 patients with concurrent thyroid benign nodule and PTC (n=20) or simple benign nodule (n=8). We carried out whole-exome sequencing on all the 127 biopsies samples and RNA-sequencing in total of 40 samples.

  Dataset EGAD00001003351

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• Single-cell RNA sequencing of sorted regulatory T cells

  Single-cell RNA sequencing of flow cytometry enriched CD4+ CD127- CD25+ regulatory T cells from 8 systemic lupus erythematosus patients (SLE_001 to SLE_007, and SLE_009) collected at baseline (day 0, before interleukin-2 immunotherpay) and day 5 (after 1 treatment cycle of interleukin-2 immunotherapy). Sorted immune cells were hash tagged and then stained with TotalSeq Human Universal Cocktail (Biolegend) before further processing for single-cell RNA sequencing using the 10X-Genomics platform (incl. generation of TCR libraries). Samples from patients SLE_001, SLE_002, SLE_004, SLE_006 were collected and processed on the first day of experiment (Day 1), and samples from patients SLE_003, SLE_005, SLE_007, SLE_009 on the second day of experiment (Day 2). On each day, samples were pooled and distributed to four lanes on the chromium controller. Run ID 245269 and ID 245270 identify samples sequenced on separate flow cells. Provided are raw sequencing files.

  Dataset EGAD50000000663

• Single-cell multi-omic analysis of control and glioblastoma samples from the brain and border regions.

  Single-cell RNA-sequencing. Some samples were analyzed using CITE-Seq and samples were multiplexed and run on the same 10X reaction

  Dataset EGAD50000000045

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• Single-cell RNA-sequencing data of human iPSC-derived (hiPSC-derived) astrocytes, both alone and in co-culture with neurons, to define the molecular response of astrocytes to misfolded alpha-synuclein.

  Samples were derived from an human iPSC-derived astrocyte line, both alone and in co-culture with neurons +/- alpha-synuclein oligomer treatment.

  Dataset EGAD50000001110

• single cell data from HPV-positive head and neck cancer patients receiving induction CTLA-4 and PD-1 immune checkpoint blockade

  Baseline and on-treatment tumor samples from human papillomavirus-positive oropharynx cancer patients receiving anti-CTLA-4 and anti-PD-1 immune checkpoint blockade were analyzed by single-cell RNA and TCR sequencing.

  Dataset EGAD50000000487

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Tomoseq data set

  This object contains raw FATSq files and processed files of the sections of an entire EMD lesions of patient PT01A and PT10. The raw files represent bulk RNA sequencing of each of the sections. The processed file is a CSV file that contains gene expression.

  Dataset EGAD50000000335

• This dataset contains the Fastq files from the RNA sequencing

  Whole blood was stimulated Ex vivo with Heat Killed M abscessus and M haemophilum or left untreated with Saline for each individual Healthy Control and MH-infected participants

  Dataset EGAD50000001566

• Sequencing data for oesophageal and related samples - Mourikis et al (RNA)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. RNAseq (BAM files) 137 samples

  Dataset EGAD00001004776

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNAseq data

  Bulk RNAseq of sigmoid colon biopsies from healthy volunteers and ulcerative colitis patients. Subjects were treated with Placebo or IL-22Fc at different doses, and biopsies were collected at day 0 and day 30 post treatment and prepared for RNA sequencing.

  Dataset EGAD00001008816

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Sequencing data for oesophageal and related samples - Ng, Contino et al (RNA)

  Data supporting: "Interplay of processes shapes structural variations undergoing selection in oesophageal adenocarcinoma" Ng, Contino et al. RNAseq (BAM files) 214 oesophageal adenocarcinoma samples

  Dataset EGAD00001007809

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Sequencing data for oesophageal and related samples - Alex Frankell et al (RNA)

  Data supporting: "The landscape of selection in 551 Esophageal Adenocarcinomas defines genomic biomarkers for the clinic." Frankell et al. RNAseq (BAM files) 116 tumours

  Dataset EGAD00001004423

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Juvenile Sjogren's Syndrome (JSS) Transcriptome Study

  Sjögren's disease (SjD) is a systemic autoimmune disorder with major clinical manifestations of dryness in the eyes and mouth, fatigue, and joint pain. Our interdisciplinary experts in SjD at the University of Florida newly discovered and established a cohort of SjD in children. Many of these patients with childhood SjD (cSjD) demonstrated a prominent feature of recurrent parotitis (RP). To understand the immunopathogenesis of childhood SjD (cSjD) for the first time in the field, we profiled the transcriptome of five groups of four PBMC samples by unbiased, high-throughput single-cell RNA sequencing (scRNA-seq): cSjD (n=4), non-cSjD (n=4), biopsy-positive non-cSjD (BP, n=4), biopsy-positive non-cSjD with RP (BPRP, n=4), and healthy controls (HC, n=4). In this study, RNA sequencing data, as well as all barcodes.tsv.gz, features.tsv.gz, and matrix.mtx.gz that may be used to create a Seurat object in R, will be availableTo protect the confidentiality of subjects, certain data were not assessed or collected in the subject phenotype dataset, such as race, age, height, weight, and education.

  Study phs003048

• Postmortem Single Nuclei and Bulk RNA-seq data of the Motor Cortex and Spinal Cord for Healthy, C9ALS and sALS Patients

  This dataset contains both snRNA-seq and bulk RNA-seq data from 19 different patients, comprising of 9 healthy controls (4 Spinal Cord, 5 Motor Cortex) as well as 5 C9ALS patients and 5 sporadic ALS patients, each with paired data from the spinal cord and motor cortex. For the snRNA-seq data, fastq files containing the raw reads are provided, many of these samples were pooled for sequencing and subsequently require demultiplexing using SNPs using a tool such as freemuxlet. The paired bulk RNA-seq data (raw fastq files) can be used to acquire the ground truth per patient - a list of pooled samples can be found in map.txt. snRNA-seq data was produced using the 10X Genomics 3' v3 kit and bulk RNA-seq was produced using the Illumina TruSeq v2 kit.

  Dataset EGAD00001009686

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• ICARUS-LUNG01 dataset

  A total of 46 frozen tumor biopsies underwent WES analysis, while 41 blood samples were used as germline controls.Tumor samples qualified for whole exome sequencing (WES) if they contained ≥10% tumor cells. For bulk RNA-seq, 20 paired baseline and on-treatment frozen tumor biopsies were analyzed. Tumor samples qualified if they contained ≥30% tumor cells.

  Dataset EGAD50000001014

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604