3924 results for "RNA AND sequencing OR transcriptome"

in 17.51 milliseconds.

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Single-cell RNA-sequencing data of human iPSC-derived (hiPSC-derived) astrocytes, both alone and in co-culture with neurons, to define the molecular response of astrocytes to misfolded alpha-synuclein.

  Samples were derived from an human iPSC-derived astrocyte line, both alone and in co-culture with neurons +/- alpha-synuclein oligomer treatment.

  Dataset EGAD50000001110

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• single cell data from HPV-positive head and neck cancer patients receiving induction CTLA-4 and PD-1 immune checkpoint blockade

  Baseline and on-treatment tumor samples from human papillomavirus-positive oropharynx cancer patients receiving anti-CTLA-4 and anti-PD-1 immune checkpoint blockade were analyzed by single-cell RNA and TCR sequencing.

  Dataset EGAD50000000487

• RNAseq of preneoplasia lung adenocarcinoma

  RNA sequencing of 168 pulmonary samples including lung preneoplasia atypical adenomatous hyperplasia (AAH, N=38), adenocarcinoma in situ (AIS, N=22), minimally invasive adenocarcinoma (MIA, N=19) and invasive lung adenocarcinoma (ADC, N=38) and adjacent lung tissues (Normal, N=62).

  Dataset EGAD50000000395

• Sequencing data for oesophageal and related samples - BOs release 2 (RNA)

  Dataset EGAD00001003840

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Single cell RNA sequencing of colorectal cancer patients (KUL5)

  All libraries were sequenced on Illumina NextSeq or NovaSeq6000 until sufficient saturation was reached.

  Dataset EGAD00001008585

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Alpha synucleinopathy spectrum - single nucleus RNA seq of prefrontal cortex

  Single nucleus RNA seq dataset from prefrontal cortex of a total of N=46 individuals with alpha synucleinopathies and healthy controls. Tissue samples correspond to patients with Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=13). RNA seq was carried out employing 10X Genomics Chromium. These samples were also sequenced using conventional bulk tissue RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000431

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• RNA-seq of longitudinal human blood and nose swab samples from a controlled human infection experiment with SARS-CoV-2 virus

  Controlled human infection experiments enable longitudinal profiling of immune responses to a pathogen. 36 healthy volunteers aged 18-29 years, with no evidence of previous infection or vaccination, were inoculated with SARS-CoV-2 virus and quarantined for 14 days. Blood samples (n=374) for RNA sequencing were collected into PAXgene tubes before virus challenge, 6 hours after challenge, daily thereafter for 14 days and on day 28. Mid-turbinate nose swabs (n=96) for RNA sequencing were collected before virus challenge, and on days 1, 3, 5, 7, 10 and 14 after challenge, preserved in RNAprotect. 18 of 36 participants developed a replicative SARS-CoV-2 infection as evidenced by consecutive PCR-positive swabs for the virus. For every participant, blood RNA from selected days were extracted and depleted for genomic DNA and globin mRNA, before cDNA libraries were constructed using KAPA RNA HyperPrep with RiboErase kits. Libraries were sequenced on the Illumina NovaSeq 6000 platform using NovaSeq 6000 S4 Reagent Kits (200 cycles). Nose swab RNA samples were extracted and depleted for genomic DNA before cDNA libraries were constructed using KAPA mRNA HyperPrep Kits. Libraries were sequenced on the Illumina NextSeq platform the using the NextSeq 500/550 High Output Kit (75 cycles).

  Dataset EGAD50000000942

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• single-cell RNA-sequencing of human/mouse colonic crypts

  Human colonic stem cells are slow cycling compared with murine rapid cycling stem cells. Our study aims to identify slow cycling stem cell in human normal colon in vivo and to analyze gene signatures among rapid cycling stem cells, slow cycling stem cells and secretory progenitor cells using single cell RNA-seqencing . We further investigated in vivo dynamics of human colonic stem cell using patient-derived gene-enginered organoids and orthotopic xenotransplantation.

  Study JGAS000550

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• RNA-seq of cultured human hematopoietic stem and progenitor cells from umblical cord blood in cytokine-rich ex vivo culture conditions following sphingolipid modulation

  In order to elucidate the biological pathways altered by sphingolipid modulation with N-(4-hydroxyphenyl) retinamide (4HPR) treatment in human HSPC that may contribute to the restraint in proliferation while promoting persistence of HSC self-renewal, as well as determine the mechanism of synergy in enhancement of HSC self-renewal with CB CD34+ agonists UM171 and StemRegenin 1 (SR1), we performed RNA-sequencing (RNA-Seq) of 3 pools of lin-CB cells following 2 or 4 days with DMSO, 4HPR, UM171+SR1 or 3-Factor (4HPR+UM171+SR1). We identified modulation of sphingolipid metabolism regulates self-renewal through activating coordinated stress pathways that coalesce on endoplasmic reticulum stress and autophagy programs.

  Dataset EGAD00001005140

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• single cell RNA-seq of bone marrow from infants with MLL-rearranged Acute Lymphoblastic Leukemia by single cell RNA-sequencing

  This dataset contains two experiments. 1) Single cell RNA-seq of diagnostic samples from patients with MLL-rearranged infant ALL that underwent relapse or not (samples ending in R relapsed, samples ending in N did not). For some of the patients, multiple indipendent plates were produced (each plate is a sample). 2) in vitro prednisolone exposure experiment. diagnostic bone marrow samples from patient 4662R were cultured for three days with and without prednisolone. Single cell experiments were conducted according to Muraro et al (cell systems, 2016, doi:10.1016/j.cels.2016.09.002). Cell barcodes and UMI sequences are embedded in the header of each fastq entry. Cell barcodes irrelevant to this experiment were removed before submission.

  Dataset EGAD00001005461

• RNA-sequencing of a representative cohort of 209 AML cases

  Sample libraries were prepped using 500 ng of input RNA according to the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche) using Unique Dual Index adapters (Integrated DNA Technologies, Inc.). Amplified sample libraries were paired-end sequenced (2x100 bp) on the Novaseq 6000 platform (Illumina) and aligned against the human genome (hg19) using STAR v2.5.4b2.

  Dataset EGAD00001007581

• Single cell RNA-seq and ATAC-seq of human fetal forebrain tissue, weeks 8 to 11.

  Single cell RNA-seq from 6 and single nuclei ATAC-seq from 3 human fetal tissue samples. Samples from 8 to 11 weeks. Includes a 8.5 weeks samples with matching both ATAC-seq and RNA-seq runs. Data was sequenced using 10X Genomics chromium technology, for scRNA-seq samples belong to v2 and v3.

  Dataset EGAD00001008653

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Bulk RNA sequencing validating an in vitro model mimicking the taNK phenotype.

  In order to obtain a sufficient amount of taNK cells for functional assays, we established an in vitro model to mimic the phenotype of taNK cells. BulkRNA sequencing was performed in order to validate the obtained phenotype comparing in vitro-generated CD103+CD49a+ (ta)NK cells with CD103-CD49a- non-taNK cells.

  Dataset EGAD50000002387

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• RNAseq of GEPARSIXTO

  294 formalin-fixed paraffin-embedded (FFPE) tissue samples were sent to the UNC Lineberger Comprehensive Cancer Center Translational Genomics Lab (TGL) for RNA isolation using the Maxwell 16 MDx Instrument (Promega AS3000) and the Maxwell 16 LEV RNA FFPE Kit (Promega AS1260) following the manufacturer’s protocol (Promega 9FB167). 279 total RNA sequencing libraries were prepared at TGL using a Bravo Automated Liquid-Handling Platform (Agilent G5562A) and the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina 20020599) following the manufacturer’s protocol (Illumina 1000000040499). RNAseq library quality and quantity were measured using a TapeStation 4200 (Agilent G2991AA) and Qubit 3.0 fluorometer (Life Technologies Q33216), pooled at equal molar ratios, and denatured following the manufacturer’s protocol (Illumina 1000000106351). 271 total RNA sequencing libraries were sequenced at TGL on NovaSeq 6000 (Illumina 20012850) S4 flow cells (Illumina 20028313) following the manufacturer’s protocol (Illumina 1000000019358) using a 2x50 bp paired-end configuration and pool sizes of 91 libraries to target a read depth of 110 million clusters per library on average.

  Dataset EGAD00001010201

• Glioblastoma stem cell lines RNA-seq (Guilhamon et al.)

  RNA was extracted from GSCs using the Qiagen RNeasy Plus kit. RNA sample quality was measured by Qubit (Life Technologies) for concentration and by Agilent Bioanalyzer for RNA integrity. All samples had RIN above 9. Libraries were prepared using the TruSeq Stranded mRNA kit (Illumina). Two hundred nanograms from each sample were purified for polyA tail containing mRNA molecules using poly-T oligo attached magnetic beads, then fragmented post-purification. The cleaved RNA fragments were copied into first strand cDNA using reverse transcriptase and random primers. This is followed by second strand cDNA synthesis using RNase H and DNA Polymerase I. A single “A” base was added and adapter ligated followed by purification and enrichment with PCR to create cDNA libraries. Final cDNA libraries were verified by the Agilent Bioanalyzer for size and concentration quantified by qPCR. All libraries were pooled to a final concentration of 1.8nM, clustered and sequenced on the Illumina NextSeq500 as a pair-end 75 cycle sequencing run using v2 reagents to achieve a minimum of ~40 million reads per sample.

  Dataset EGAD00001006813

• Single cell RNA-seq of 24 samples from 13 individual human embryonic meninges of PCW 5.0-13.0 using 10X chromium technology

  A total of 24 samples of meninges from 13 normal human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development. All libraries were sequenced on an Illumina NovaSeq 6000 using S4 to a target sequencing depth of 100,000 reads/cell. Final data after processing with STARSolo 2.7.10a, using human genome GRCh38.p12 and transcript annotations from ENSEMBL release 93 from reference package GRCh38-3.0.0 as available from 10Xgenomics, consists of 24 BAM files.

  Dataset EGAD50000001434

• Single-cell RNA sequencing of breast cancer lung metastasis and adjacent normal tissue

  This dataset contains single-cell RNA sequencing data from two samples: L1 (breast cancer metastasis to lung) and N3 (adjacent normal lung tissue) from a female patient. The samples were processed using 10X Chromium 3' technology and sequenced on Illumina NextSeq 500. This data supports the study "Endocrine therapy reprogramming of breast cancer facilitates metastatic escape via upregulation of P-Rex1/Rac1 signalling" which investigates how endocrine therapy reprograms breast cancer cells, leading to upregulation of P-Rex1/Rac1 signalling pathways that facilitate metastatic escape. The single-cell analysis reveals cellular reprogramming mechanisms in endocrine therapy-resistant breast cancer cells that form metastases in the lung.

  Dataset EGAD00001015769

• Single cell RNA sequencing data in "Three-dimensional human alveolar stem cell culture models reveal infection response to SARS-CoV-2"

  This dataset includes a total of 5 single cell RNA sequencing (scRNAseq) data of SARS-CoV-2 infected human alveolar stem cell culture models. Two scRNAseq data were obtained from SARS-CoV-2 infection with MOI of 1.0 (1 for control and 1 for infected case) and the other three were obtained from SARS-CoV-2 infection with MOI of 0.1 in the study entitled "Three-dimensional human alveolar stem cell culture models reveal infection response to SARS-CoV-2". The 10x Chromium Single Cell 3' Reagent kits were used to generate libraries.

  Dataset EGAD00001006242

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing muscle during affected phase to healthy control, and affected patient with and without additional EARS2 mutations.

  Illumina Nextseq total RNA sequencing profiles of skeletal muscle biopsies of 5 affected patients (F3/2M, F4/1F, F5/1M, F2/2F, F2/1M) compared to 6 control (Control040500, Control3509, Control3934, Control3949, Control4994, Control5106) and comparing 3 patients with additional EARS2 mutations (F2/2F, F2/1M, F5/1M) to 2 patients without (F3/2M, F4/1F). Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006381

• Single-cell RNA-seq of human kidney tumors

  Fresh nephrectomy samples were collected from a total of 5 untreated ccRCC patients. Out of these 5 patients, 7 samples were obtained. Two samples consisted of fresh versus frozen single cells from the primary tumor site of one patient. Two other samples consisted of matched primary and distant thrombus sites (the vena cava) of a second patient. The three remaining samples came from the primary tumor sites of three distinct ccRCC patients. Single-cells were captured into 10x barcoded gel beads and RNA-sequencing library preparation was done using Chromium Single Cell 3' v2 chemistry. Sequencing was performed on a Illumina HiSeq 4000 sequencer.

  Dataset EGAD00001009306

• Non-invasive prediction of immunotherapy response (NIPIT) project

  This project aims to find transcriptomic biomarkers for immunotherapy response prediction in several cancer types. So far, we have performed poly-A RNA-seq using whloe blood and peripheral blood mononuclear cells from 33 non-small cell lung cancer patients, collected before and after the start of immunotherapy.

  Study EGAS50000000266